SGN Marker T0702

SGN-M1550
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07
Tomato EST read: TMEDA10TH
Arabidopsis best BAC match: AC007234.3
Arabidopsis position: 1.1268000
Arabidopsis identities: 0.689
Best GenBank protein hit: AAF23833.1
Evalue: 3.1e-49
Identities: 0.583
Description: similar to microsomal glutathione S-transferase 3 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49541)
Chromosome
2
Position
39.98 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47475)
Chromosome
2
Position
85.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39395)
Chromosome
2
Position
76.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0702 was used as an overgo probe on plate 1 [well F9]

Plausible BAC Matches:   P247G02,   P198A03,   P268M07,   P165K22,   P288A06,   P058O05,   P318N24,   P243K11

 Overgo Sequences

A sequence
GTTATTCCACTGGCGATCCCCAAA
B sequence
CCAAGAGTAAGCCGATTTTGGGGA
AB sequence
GTTATTCCACTGGCGATCCCCAAAATCGGC
Marker sequence
CCATGGCCGGAGTTGAATTCCTCCCCAAAGAATATGGATATGTAATTCTT
GCTCTTGTCGTCTACTGTTTCTTCAACTTCTGGATGTCCTTTCAAGTCGG
CAAAGCCCGCAAACAGTACAAGGTTCCTTATCCAACAATGTATGCTACTG
AAGCTGAAAACAAGAATGCTAATTCCTTTAACTGTGTTCAGAGAGGTCAT
CAGAATTCATTAGAAATGATGCCAACATTTTTCATGCTGATGATTGTTGG
AGGAATTAGGCACCCCTTGATTTGTGCATCTCTTGGAGCTGTTTATATTG
TATCTCGCTATTTCTACTTCACTGGTTATTCCACTGGCGATCCCCAAAAT
CGGCTTACTCTTGGGAAATACAATTTCTTGGCAATTATGGCACTGATGAT
TTGCGCAGCATCTTGTGGAGTTAATTTTCTTATGTCATGAATATTAGTCT
CAAATAGAGTAACCTCCTTGTAATTCCCTTTATTTCCAGTAAGAAATGAT
GTCTTTTTTATGTCTGTTTTGTCATTAATATGAATTGAATTGGTACTTTC
TGTATCAAGTTACCTCNNNNC
Genomic location of T0702  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1550 marker 1550
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)