Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0710

SGN-M1556
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TMEDA41TH
Arabidopsis best BAC match: AB016885.1
Arabidopsis position: 5.2500000
Arabidopsis identities: 0.550
Best GenBank protein hit: CAC09580.1
Evalue: 3.5e-45
Identities: 0.505
Description: protein kinase (PK) [Fagus sylvatica]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39400)
Chromosome
2
Position
62.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0710 was used as an overgo probe on plate 10 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCATGGTGTTGGGAGGGTGAGTT
B sequence
TCTGCTGTTTCCACAGAACTCACC
AB sequence
ATCATGGTGTTGGGAGGGTGAGTTCTGTGG
Marker sequence
GAAATGGATGATGAAGCTAATTCTTGGATTAGGAGAACAAAGTTTTCTCA
TACAGTTTGTCATAGGTTGGATTCTGCAAGATTGACGTCTATTCCTATTA
GTACTATTCAGTCAGGAAGAATTGCTGGAGCAAAAACTAGACCTGGATCA
GGTTCTTTTAATTCAATACCTGAGCCAACTGTTGCGCCTCTTCAGCGCAA
TCCAACTACAAACAAACATAGGACTGTATCACCTCATCCAGAAACATCAG
TTCCAGATACCTTTAAGGAGGCTCGATCTAGTCAGAAGAGATTTTCAACT
CCGCGTCCACAAAGGAAGGAACATGAGAAGAAGATTGTGAGTAAGTCGTT
TTATAAAGATTCTAGGGAATCGAAATCACCTACGTTGAGATCTCCTGGTT
CAAGATCTCCATCAAATACAAGTCCCCTACGGCATTTCACATCATTCAAA
TTCCATGACAAAACAAAGAGCCGAAAGGATTCAGCATGGAGTAGGTACTT
TGATCATGGTGTTGGGAGGGTGAGTTCTGTGGAAACAGCAGATGAATATA
CAATTGATCTTTCTAAGC
Genomic location of T0710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1556 marker 1556
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)