SGN Marker T0712

SGN-M1557
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEDA43TH
Arabidopsis best BAC match: AB024036.1
Arabidopsis position: 3.0580000
Arabidopsis identities: 0.806
Best GenBank protein hit: BAB02821.1
Evalue: 6.9e-34
Identities: 0.867
Description: contains similarity to protein translation inhibitor~gene_id:MQC12.17 [Arabidopsis thaliana]
Comment: compare with TMEAV47TH
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39401)
Chromosome
10
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0712 was used as an overgo probe on plate 1 [well E6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACCTCGAAAAGGAGAAAGTCTGC
B sequence
GTAGGCTAGGAAGTCAGCAGACTT
AB sequence
GACCTCGAAAAGGAGAAAGTCTGCTGACTT
Marker sequence
TTGTCTCAGAAAGTGTGGAGGATCAAACAGAGCAGGTTCTCAAGAATATG
GGGGAGATACTTAAAGCAAGTGGTGTTAGCTACTCCTCAGTTGTTAAGAC
AACTATCTTGTTAGCTGATCTGAATGACTTCAAGAAAGTGAATGAGATTT
ATGCAAAATATTTTCAAGCTCCTGCACCAGCTCGGGCAACTTATCAGGTA
GCAGCACTGCCAATGAATGCAAGGATTGAAATTGAGTGCATAGCAGCATT
ATGATTCTCCCTTACCTATTCATTCAACAACTTATTAGACCTCGAAAAGG
AGAAAGTCTGCTGACTTCCTAGCCTACATTCGTAGATTTAATAAGCCTGG
AGTTAGCTACTAGTCCAGGAGCCCTTGTCTAACTTCGCGGAGCTGAGAAT
AAACTTTATTTAAGAACGTATTGTAACTGATCTGCATGAGTATTACATAT
ACAATTGTGCTACTCTATTGGGAAGAAC
Genomic location of T0712  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1557 marker 1557
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)