Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0718

SGN-M1560
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECZ67TH
Arabidopsis best BAC match: AC006585.7
Arabidopsis position: 2.1410000
Arabidopsis identities: 0.747
Best GenBank protein hit: AAD23019.1
Evalue: 3.3e-39
Identities: 0.750
Description: putative steroid-binding protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49544)
Chromosome
8
Position
22.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47478)
Chromosome
8
Position
26.39 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39402)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0718 was used as an overgo probe on plate 12 [well F3]

Plausible BAC Matches:   P282B23,   P317D24,   P298D02

 Overgo Sequences

A sequence
AAGATGGAGCTAACCGCGGATGAG
B sequence
CGTCATATGCCTTCAGCTCATCCG
AB sequence
AAGATGGAGCTAACCGCGGATGAGCTGAAG
Marker sequence
TGAAGATGGAGCTAACCGCGGATGAGCTGAAGGCATATGACGGATCAGAT
CCATCAAAGCCAATTTATGTTGCAATCAAAGGTCGAATCTTCGATGTAAG
CGCCGGTAATTCGTTCTATGGTCCCGGCGGGCCTTACTGTATGTTCGCCG
GAAAAGATGCAAGCAGAGCACTTGCAAAGATGAGCAAGAATGAAGAAGAT
GTTTCTCCATCTCTTGATGGATTATCTGAGAAAGAAATGGCTGTTCTCAA
TGATTGGGAGACCAAATTCGAAGCTAAGTATTCAATTGTTGGAAATGTCA
TTTCTTAATTACTTTTCCATCTGGGAATTATGAAGAAATAAATAAATGGT
TTCCTATTTGCTCATCGATCTGTGTTTATGCAAAGACAAGATTAATTATG
AATAAATTTTACCCTTG
Genomic location of T0718  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1560 marker 1560
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)