SGN Marker T0721

SGN-M1563
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEDA63TH
Arabidopsis best BAC match: AB008266.1
Arabidopsis position: 5.2810000
Arabidopsis identities: 0.952
Best GenBank protein hit: AAA93075.1
Evalue: 1.6e-51
Identities: 0.660
Description: PSI-N [Arabidopsis thaliana]
Comment: photosystem I reaction centre subunit psaN precursor
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49546)
Chromosome
8
Position
3.05 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47480)
Chromosome
8
Position
13.99 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40813)
Chromosome
8
Position
15.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39404)
Chromosome
8
Position
11.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0721 was used as an overgo probe on plate 12 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGAAGAGGTTGGCTACAAGTGG
B sequence
CCTTGCGAAATTCGCACCACTTGT
AB sequence
CAAGAAGAGGTTGGCTACAAGTGGTGCGAA
Marker sequence
GGAAAAGAAGAAATGGCAGCAATGAACTCAAGTGTATTGGCTTGCAGCTA
TGCTATATCAGGCATGAGTTCATCTGAACTCACATCAAAACATACTGTTA
CTACTATGTCTTCCCCTTCACTTCAAAAATTGCCACTCATCATTAAGGCT
CAACAACAATCCAGTTCCAACATATCTGCTGGAAGAAGAGTTGCTCTGCT
TGGCCTTGCTGCTGCACTTTTCACATCTGCCTCTTCTGCTAATGCTGGTG
TTATCGACGAATATCTTGAGAAAAGCCAAGCCAACAAGGAATTGAATGAC
AAGAAGAGGTTGGCTACAAGTGGTGCGAATTTCGCAAGGGCGTATACTGT
TCAGTTTGGAACCTGCAAGTTCCCTGAGAACTTTACAGGATGCCAAGACC
TTGCAAAACAAAAGAAAGTGCCATTTATAAGTGACGATTTGGCGTTGGAG
TGTGAAGGCAAGGACAAATACAAGTGTGGTTCAAATGTGTTCTGGAAATG
GTGAAGCTTAGCTTGAAGAAATGTATTAATCGTTTCCCAAAATGTATCTA
TTGTGACAATGAGAAGTAATTTACCATCCATTTTC
Genomic location of T0721  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1563 marker 1563
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)