SGN Marker T0723

SGN-M1565
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TMEDA64TH
Arabidopsis best BAC match: AC006955.5
Arabidopsis position: 2.0230000
Arabidopsis identities: 0.777
Best GenBank protein hit: CAA54409.1
Evalue: 1.7e-38
Identities: 0.710
Description: ferredoxin-thioredoxin reductase SU B [Spinacia oleracea]
Comment: reduces thioredoxin
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39405)
Chromosome
2
Position
95.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0723 was used as an overgo probe on plate 12 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTCGGAGCAGAAAACGAGACAAC
B sequence
CGGTAGTTGTTGCTTCGTTGTCTC
AB sequence
AGTCGGAGCAGAAAACGAGACAACGAAGCA
Marker sequence
GACTCAATCGGAAAGTCGGAGCAGAAAACGAGACAACGAAGCAACAACTA
CCGGAATCCGCCATGAGAACTCTTCAAGCTTCCACCTCCTACAGCGTTGG
CTTTGGAATTTCATCTTTTGCTACTCGTCCTAAGCCTTCTTCTACTCATC
GCTGCCTCACCGTAGCCAAAATGGAGCCATCAGAGAAATCTTGTGAAATC
ATGAAGAAATTCTCGGAGCAGTATGCTCGCAGGTCAGAAACATATTTCTG
CATGGACAAAAGTGTTACTTCTGTGGTCATCAAGGGTTTGGCAGAGCACA
AGGATACATTGGGTGCTCCACTCTGCCCCTGCAGGCATTATGATGACAAA
GCTGCAGAAGCGCAGCAGGGCTTCTGGAATTGTCC
Genomic location of T0723  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1565 marker 1565
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)