SGN Marker T0724

SGN-M1566
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDA65TH
Arabidopsis best BAC match: AC002986.1
Arabidopsis position: 1.1499000
Arabidopsis identities: 0.757
Best GenBank protein hit: AAC17079.1
Evalue: 6.1e-15
Identities: 0.655
Description: Contains similarity to C2-HC type zinc finger protein C.e-MyT1 gb|U67079 from C. elegans [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49547)
Chromosome
10
Position
64.60 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47481)
Chromosome
10
Position
86.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39406)
Chromosome
10
Position
86.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0724 was used as an overgo probe on plate 15 [well A11]

Plausible BAC Matches:   P306G19,   P188J21,   P099A21,   P056G15,   P013B20

 Overgo Sequences

A sequence
GCTGCTTATTCAGTGCTCGCAAAC
B sequence
GCAACTGCTTGTAGTGGTTTGCGA
AB sequence
GCTGCTTATTCAGTGCTCGCAAACCACTAC
Marker sequence
TGACAAATGGGAATATCTTGCTTGTGTTCAACTCTCTGTAGATTTCCAGT
AGATTATCCACAGTGGTTGGTCAGCCAAACCCATGGCTATGGCTGCTTAT
TCAGTGCTCGCAAACCACTACAAGCAGTTGCCACAAGTACTGTCCTTGTC
GATGTTTCTCAGGAAGGACGGAAATACGTTACTGCTACGGAGTTGCGGAA
GCCAATAACTGCGGCGATACTGGCGGCAGCTGCAGCATGTGCTGTGATTG
TAGCGGTGAATGGGGCGGAAGCGTTGGCGGTGCCGGCGCAGATTGAAACG
CAACAGGAGGTACTTGGTGAGACATTTTCGAATGTACCGCAAACGTTATC
CGGCGATTGTGTTGATGGTCAGAAGAATTGCAAGAAGGCGAGGATTCAAA
GACCTAAGTCAAGGCAAGCAGAGACTTGCACGGTCAAATGTGTCAATACT
TGTATTCGTGGTGGCAGTGGATCTCCTGGTGAAAGTCCTCTTAACGTAA
Genomic location of T0724  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1566 marker 1566
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)