SGN Marker T0729

SGN-M1570
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.04
Tomato EST read: TMEDA81TH
Arabidopsis best BAC match: AL353994.1
Arabidopsis position: 5.0159000
Arabidopsis identities: 0.836
Best GenBank protein hit: CAB89365.1
Evalue: 9e-100
Identities: 0.862
Description: inorganic pyrophosphatase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39853)
Chromosome
1
Position
144.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0729 was used as an overgo probe on plate 9 [well D1]

Plausible BAC Matches:   P162K02,   P071F18

 Overgo Sequences

A sequence
AACATTTTCCGGGCACTCTCACAG
B sequence
AACCAGTCCCTGATTGCTGTGAGA
AB sequence
AACATTTTCCGGGCACTCTCACAGCAATCA
Marker sequence
GCAGACAATTCCGGCAAAAAGATATCCCCTTGGCATGACATACCACTACA
TTTGGGTGATGGTGTTTTCAATTTTGTTGTTGAGATCCCCAAAGAATCAA
GTGCAAAGATGGAAGTTGCTACAGATGAGCAACACACTCCTATTAAACAA
GACACAAAGAAGGGGAAACTTCGATACTATCCATATAATATTCACTGGAA
CTATGGATTGCTTCCTCAAACATGGGAAGATCCTACTTTTGCGAATACCG
AAGTTGAAGGGGCATTAGGTGATAATGACCCTGTTGATGTTGTTGAGATT
GGGGATAGCCGAGGTAAAATTGGCCAGGTTCTGAAGGTCAAACCTTTAGC
TGCTCTGGCAATGATTGATGAAGGAGAACTTGACTGGAAAATAGTTGCTA
TTTCACTAGATGATCCAAGAGCTTCACTTGTTAATGATGTTGATGATGTG
GAAAAACATTTTCCGGGCACTCTCACAGCAATCAGGGACTGGTTTAGAGA
CTATAAGATACCTGATGGAAAACCTGCTAATAGGTTTGCTCTTGGCAACA
AGCCAACAAACAAGGATTACGCTCTTAAGATTATTACCGAA
Genomic location of T0729  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1570 marker 1570
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)