SGN Marker T0730

SGN-M1571
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECZ94TH
Arabidopsis best BAC match: AC007067.4
Arabidopsis position: 1.0300000
Arabidopsis identities: 0.768
Best GenBank protein hit: AAD39571.1
Evalue: 2.3e-22
Identities: 0.803
Description: unknown[Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53149)
Chromosome
5
Position
38.67 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49550)
Chromosome
5
Position
61.25 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47484)
Chromosome
5
Position
90.84 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40814)
Chromosome
5
Position
70.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36564
Forward primer (5'-3')
GGATGCTCGGGAATGTCATA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CATCGCTGTAGTCCAGTTGC
Digested band sizes (using BclI)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
1056
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39854)
Chromosome
5
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0730 was used as an overgo probe on plate 11 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCAGGTTTCAATGGCTTTCTCTG
B sequence
GACCATCGAAGAGTTGCAGAGAAA
AB sequence
TGCAGGTTTCAATGGCTTTCTCTGCAACTC
Marker sequence
GTGATTTGCAGGTTTCAATGGCTTTCTCTGCAACTCTTCGATGGTCATGT
TGTCTACACCGCCCTTCGAAGAATTCAACAATTTCAAGCGTGTTGCCTCA
ATCATCTTCTTCAATCTCCTTTCGATCTTCGCCTTCGTTTTTTAATCGCA
AAAAATCATTGCCTATTCGATCTGGTACACTTGAAGCAGCACCTGCATCT
GGAGGAGTAGCACCTGCAATTTCCTTAACTGACAATGCATTAATGCACTT
GAATAAAATGAGGAGTGATCGGAATGAGGACTTGTGTCTTAGAATTGGCG
TTAAACAAGGGGGATGCTCGGGAATGTCATACACTATGGATTTTGAAAAG
CGAGAAAATGCTATACCAGACGATTCAATCATCGAGT
Genomic location of T0730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1571 marker 1571
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)