SGN Marker T0731

SGN-M1572
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEDB87TH
Arabidopsis best BAC match: AC002328.2
Arabidopsis position: 1.0997500
Arabidopsis identities: 0.784
Best GenBank protein hit: CAA31524.1
Evalue: 1.3e-50
Identities: 0.735
Description: PSI subunit V preprotein (AA -69 to 98) [Spinacia oleracea]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39409)
Chromosome
7
Position
93.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0731 was used as an overgo probe on plate 8 [well A6]

Plausible BAC Matches:   P167K07,   P016G13

 Non-Plausible BAC matches

P101B16,   P104D04,   P175E15,   P101J20,   P335L02

 Overgo Sequences

A sequence
CACCAACTTTCCAAGGTCTCAGAC
B sequence
GTGGGTTTGTTGAGAGGTCTGAGA
AB sequence
CACCAACTTTCCAAGGTCTCAGACCTCTCA
Marker sequence
TCTGTTTTCTGCACCAACTTTCCAAGGTCTCAGACCTCTCAACAAACCCA
CCGACTCTTCCCTCTTCCTCAACAAACCCATCGCCTTCAAACCTATCACC
AAAAAACCCCGAAATCTCGCTGTGAAAGCTGAACTCAATCCATCCGTTGT
CATCAGTTTGAGCACTGGGCTTTCGCTTTTCCTTGGAAGGTTCGTTTTCT
TCAATTTCCAGAGAGAAAATGTAGCGAAACAGGTGCCATCTCAGAATGGA
ATTTCTCACTTTGAAGCTGGAGATGTTAGGGCTAAGGAATATATAAGTTT
GTTAAAATCAAATGATCCAGTTGGATTCAATATTGTTGATGTGCTTGCTT
GGGGATCTATTGGACATATTGTTGCTTATTATATCCTTGCTACTTCTAGC
AATGGATATGATCCCAGTTTCTTTGGCTGAATATCAAACAAAAATATATT
TACTATATGTGTTTTTGTTAACTGATTTTATGTGAAATTCATGTGGTTTT
GTGCCAAAGAATTACTAGT
Genomic location of T0731  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1572 marker 1572
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)