SGN Marker T0736

SGN-M1575
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.03
Tomato EST read: TMEDF36TH
Arabidopsis best BAC match: AP000420.1
Arabidopsis position: 3.0960000
Arabidopsis identities: 0.916
Best GenBank protein hit: BAB02186.1
Evalue: 3.9e-82
Identities: 0.917
Description: vacuolar ATP synthase subunit AC39 [Arabidopsis thaliana]
Comment: ATP synthesis: Energy metabolism
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39855)
Chromosome
10
Position
59.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0736 was used as an overgo probe on plate 15 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACAGTGGCTATTTGGAAGCCATC
B sequence
ATCGGTGACCTCTAACGATGGCTT
AB sequence
CACAGTGGCTATTTGGAAGCCATCGTTAGA
Marker sequence
AATTTCTCCAAATTCCGCTTCAGATCTGTATCTGTGGAGGATTCTATATC
AACCATGTACGGATTCGAAGCGCTTACCTTCAACATTCACAGTGGCTATT
TGGAAGCCATCGTTAGAGGTCACCGATCTGGTCTTCTCACCGCTGCAGAC
TACAACAATCTATGCCAGTGCGAAACTCTAGATGACATCAAGATGCATCT
GTCCGCTACTGAATACGGTCCTTATCTCCAAAATGAGCCTTCCCCTTTAC
ACACTACTACGATTGTGGAGAAATGTACTGTCAAACTTGTAGATGAGTTC
AACCACATGCTCTGCCAAGCCACAGAACCCTTGTCAACCTTTCTGGAATA
CATCAGGTATGGCCACATGATTGACAATGTTGTCCTAATTGTCACCGGAA
CTTTGCATGAGAGAGATGTCCAAGAACTGTTGGAGAAATGCCATCCTTTG
GGCATGTTTGACAGCATTGCTTCTTTGGCAGTTGCCCAGAATATGAGGGA
ATTATACAGGCTGGTGCTTGTTGAC
Genomic location of T0736  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1575 marker 1575
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)