SGN Marker T0743

SGN-M1580
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDF54TH
Arabidopsis best BAC match: AC002561.2
Arabidopsis position: 2.2290000
Arabidopsis identities: 0.735
Best GenBank protein hit: AAB88646.1
Evalue: 4.0e-51
Identities: 0.751
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39416)
Chromosome
10
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0743 was used as an overgo probe on plate 16 [well H4]

Plausible BAC Matches:   P148H01,   P020A12,   P281H24

 Overgo Sequences

A sequence
TTAATGGAGCAGTGGGTGGATTCG
B sequence
ACAGAAGCACCAGCAACGAATCCA
AB sequence
TTAATGGAGCAGTGGGTGGATTCGTTGCTG
Marker sequence
AATCGCGAAACAGATCAGTGCGATTTCCAGCTTGAGTAAAATCATGGATG
AGGCTGCAGAGCTAAGGTATTATGAAGAGGAGGATACAGCAGGGATGAAA
ACACTGAAAGGGGCAACCTCAGGTCTAGTTGCTGGTACACTTTGGGGTGC
CATTATTGCCACTTGGCATGATGTACCCCGTGTTGAGAGAAATGTTGCTC
TTCCTGGCTTGATCCGGACATTGAAAATGATGGGAAACCACGGGCTTACC
TTTGCTGCTATTGGCGGAGTCTATATAGGGGTAGAACAGCTGGCGCAGAA
CTATAGGGTGAAAAGAGATTTTATTAATGGAGCAGTGGGTGGATTCGTTG
CTGGTGCTTCTGTGCTGGGTTACAAAGGAAGGAGTATTCCAACAGCTCTG
TCAGCTGGGGCTGCACTTGCAGTCACTTCTGGTATAATTGATGGACTATG
CGCAACCACAAGAACTGACAATGGCAAGGAGTACTATCCTTACACA
Genomic location of T0743  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1580 marker 1580
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)