SGN Marker T0751

SGN-M1583
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.04
Tomato EST read: TMEAL10TH
Arabidopsis best BAC match: AC005724.2
Arabidopsis position: 2.1100000
Arabidopsis identities: 0.785
Best GenBank protein hit: CAA91162.1
Evalue: 1.8e-56
Identities: 0.806
Description: SecY [Spinacia oleracea]
Comment: "SecY is an essential, hydrophobic component of the membrane-bound translocase complex in bacteria and is also present in chloroplasts"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39417)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39418)
Chromosome
6
Position
71.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0751 was used as an overgo probe on plate 4 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTGGCATCCTAGTCTCGTTCTTC
B sequence
TGCTAAGGACTAGCAGGAAGAACG
AB sequence
GTTGGCATCCTAGTCTCGTTCTTCCTGCTA
Marker sequence
GAAGGGTGCAACCATGCTAGCTTGTGCACCATTGCCGCGGGTGGCAACAG
CTGCTGAGGACATTACTGAAGAAGCCATTGCTGCTGATTTAAAACTTGGA
AATGGTACATCTCTTTTGATCTTTACAAATATCATCTCCTACTTGCCAGC
GTCCTTTGGTAGGACAGTCGCGCAGGCCTATCAAGATGGTAATTATGTTG
GGCTCGTTGGCATCCTAGTCTCGTTCTTCCTGCTAGTCCTTAGCATTGTA
TATGTTCAGGAAGCAGAGAGGAAAATTCCGCTAAATTATGCATCAAGGTA
TACTGGCAGAACAGGAGGAGGACTTCAAAAATCTGCATACTTACCATTTA
AAGTGAACAGTTCAGGAGTAATGCCGATTATTTTCTCTACATCATCACTA
GCCCTTCCTGGCACTTTGGCACGTTTCACCGGTGTAGGTTTTCTGAGAAA
CGCTGCAGCAGGTTTAAACCCCTGAGGTTCTTTCTATCTGCCGACAAACA
TTTTGGTGATTGCCCTCTTCAATTACTATTATACATTCCT
Genomic location of T0751  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1583 marker 1583
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)