SGN Marker T0760

SGN-M1587
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TMEAL43TH
Arabidopsis best BAC match: AC006424.5
Arabidopsis position: 1.0720000
Arabidopsis identities: 0.931
Best GenBank protein hit: AAF31280.1
Evalue: 6.2e-38
Identities: 0.697
Description: Very similar to Spinacia oleracea 50S ribosomal protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39423)
Chromosome
8
Position
87.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39424)
Chromosome
10
Position
35.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0760 was used as an overgo probe on plate 16 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATCCAGGGAAACTCTGTTCCTC
B sequence
GGAGGAAGGTGAAAACGAGGAACA
AB sequence
TCATCCAGGGAAACTCTGTTCCTCGTTTTC
Marker sequence
TCTTTATCGAGTTGTAATCATCCAGGGAAACTCTGTTCCTCGTTTTCACC
TTCCTCCCTTAAGTTGTCATGGGTCCAACGCGTGTCGGTTCAGTTCATTC
ACACCCAAAACCACACTTGTTCCCTTCCTTATGCTCCAAGGGCTCTCACT
GTCATTTCCATGGCCCCCCCTAAGCCCGGTGGTGGTAAAGCGAAGAAAGT
CACTGGTATTATAAAGTTAGCTCTCGAGGCAGGGAAGGCAACCCCAGCTC
CACCCGTGGGGCCGGCCTTGGGTTCCAAAGGTGTTAACATCATGGCATTC
TGTAAGGATTACAATGCCAGAACTGCTGACAAAGCTGGTTATGTTATTCC
TGTGGAAATCACCGTCTATGATGATAGAAGCTTCACTTTTATCTTGAAGA
CCCCACCTGCTTCTGTTTTGCTGCTCAA
Genomic location of T0760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1587 marker 1587
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)