SGN Marker T0763

SGN-M1590
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: None
Arabidopsis best BAC match: AC006193.3
Arabidopsis position: 1.1250000
Arabidopsis identities: 0.740
Best GenBank protein hit: AAD38248.1
Evalue: 4.6e-16
Identities: 0.584
Description: Putative membrane related protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39426)
Chromosome
8
Position
87.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0763 was used as an overgo probe on plate 12 [well E8]

Plausible BAC Matches:   P182H10,   P318D24,   P185M07,   P157A18,   P172A19,   P064M21,   P331H01,   P201M14,   P271K13,   P229A18,   P219C20,   P185F10

 Non-Plausible BAC matches

P147N04,   P094G18,   P134A11

 Overgo Sequences

A sequence
CCCTTGCTTGTAGTCTTGATCGTG
B sequence
GCTTTTGTCAGGAGTCCACGATCA
AB sequence
CCCTTGCTTGTAGTCTTGATCGTGGACTCC
Marker sequence
TTTCATGGCGCAGGTCAACACCAAAGTTGATATTGAGAATCTCAGATCAA
TGGGGAGCGAAACCTATCTTTCTGAGATTGAGCGTGAGGATTCACCTGAG
AAGCCTGCAGGGAGGATCATACCGCGGTTCTTAGTTGTTGGTGGGGCAAT
TGCCCTTGCTTGTAGTCTTGATCGTGGACTCCTGACAAAAGCGGTTATAT
TTGGAGTTGCTAGAAGGTTTGCAGGGATTGGGAAAGGTTGTGAAACTGCT
CTAGTATGGGTCGAGGCATTNTTATATACATCATTTGATCGATAGGAGAA
CATACTTTGGCAGCAAGGTAGCCAC
Genomic location of T0763  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1590 marker 1590
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)