SGN Marker T0765

SGN-M1591
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TMEAL57TH
Arabidopsis best BAC match: AC008153.3
Arabidopsis position: 3.0160000
Arabidopsis identities: 0.965
Best GenBank protein hit: AAF00665.1
Evalue: 9.3e-50
Identities: 0.941
Description: putative 40S ribosomal protein s14; 67401-66292
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39427)
Chromosome
9
Position
36.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0765 was used as an overgo probe on plate 16 [well A2]

Plausible BAC Matches:   P269B20,   P289N02

 Overgo Sequences

A sequence
CGCATTACTGGTGGAATGAAGGTG
B sequence
CATCTCTGTCAGCCTTCACCTTCA
AB sequence
CGCATTACTGGTGGAATGAAGGTGAAGGCT
Marker sequence
CAACGAGGGAAGGTGAATTGGTGTTCGGTGTTGCACACATTTTTGCATCG
TTCAATGATACATTCATTCACGTTACTGATTTGTCTGGAAGAGAAACTAT
GGTTCGCATTACTGGTGGAATGAAGGTGAAGGCTGACAGAGATGAGTCTT
CTCCGTATGCTGCTATGCTTGCAGCTCAGGATGTGTCACAGCGATGCAAG
GAACTTGGAATTAATGCTCTTCACATTAAGCTCCGAGCTACAGGAGGCAA
CAAGACCAAGACTCCTGGTCCTGGTGCCCAGTCCGCTCTTAGAGCTTTGG
CTCGTTCTGGCATGAAAATTGGACGTATAGAGGATGTTACTCCAATTCCC
ACCGATAGTACTCGCAGAAAGGGTGGTAGAAGGGGAAGGAGGCTGTGAAG
ACTCTTTCTCTTTTCTGCAGCATGTTGCAAATTGGAGGAAAATATTGTTG
TCGAAAAATGCAGCTTTCGATATCTATTTACATTTGATTTCTGAACACTC
TGTAGTTGAGCACTTTTGGTTTCGAAACCACCTTCATT
Genomic location of T0765  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1591 marker 1591
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)