SGN Marker T0770

SGN-M1595
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.01
Tomato EST read: TMEAI70TH
Arabidopsis best BAC match: AC002376.1
Arabidopsis position: 1.0100000
Arabidopsis identities: 0.920
Best GenBank protein hit: CAA04451.1
Evalue: 7e-117
Identities: 0.985
Description: putative beta-subunit of K+ channels [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49559)
Chromosome
12
Position
64.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47493)
Chromosome
12
Position
100.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39429)
Chromosome
12
Position
101.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0770 was used as an overgo probe on plate 3 [well D12]

Plausible BAC Matches:   P155J24,   P182M21,   P041E11,   P251B12,   P183M06,   P265O22

 Overgo Sequences

A sequence
GCTCAGCAGATTACTGAAGCATGG
B sequence
ATCTTTGAGCAACCCCCCATGCTT
AB sequence
GCTCAGCAGATTACTGAAGCATGGGGGGTT
Marker sequence
CTTTTACAGTGTTGTCGTGACCATGGTGTCAATTTCTTTGATAATGCTGA
GGTTTATGCTAATGGCAGAGCAGAAGAAATCATGGGTCAAGCGATTCGTG
AACTTGGGTGGAAAAGATCGGACATTGTTGTGTCAACAAAGATATTTTGG
GGTGGTTCTGGTCCAAATGATAAAGGGCTTTCAAGAAAACATATAATTGA
AGGAACAAAAGCTTCATTGAAGAGACTTGATATGGATTATGTAGATCTGA
TCTATTGTCATAGGCCTGATACAAGTACACCTATTGAAGAAACTGTTAGG
GCTATGAACTATGTGATTGATAAAGGGTGGGCTTTTTATTGGGGTACAAG
TGAATGGTCAGCTCAGCAGATTACTGAAGCATGGGGGGTTGCTCAAAGAT
TGGATCTTGTTGGTCCCATTGTTGAGCAGCCTGAGTATAACTTGTTGTCT
AGGCATAAGGTTGAATCTGAGTACCTCCCTCTCTATAGCAACTATGGAAT
TGGTCTTACCACATGGAGTCCTCTCGCTTCAGGCGTTCTGACTGGAAAAT
ATACCTCAGGGAACATTCCACCAGACAGTCGATTTGCACTGGAAAATTAC
AAGAAT
Genomic location of T0770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1595 marker 1595
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)