SGN Marker T0772

SGN-M1596
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: None
Arabidopsis best BAC match: AL049659.2
Arabidopsis position: 3.1140000
Arabidopsis identities: 0.828
Best GenBank protein hit: CAB41156.1
Evalue: 4.1e-34
Identities: 0.821
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39430)
Chromosome
3
Position
87.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0772 was used as an overgo probe on plate 6 [well H3]

Plausible BAC Matches:   P249J03,   P103A08,   P152L09,   P191N05,   P099O23,   P114B14,   P153J02,   P140O01,   P073E05,   P185O10,   P066M12,   P189N04,   P065N07,   P065I21,   P250J11,   P175B09,   P125M07,   P286B15,   P123N09,   P159H13,   P250P03,   P138J02,   P160H08,   P249M24,   P011L07,   P175B10,   P101O16,   P064I21,   P077H09,   P158G10,   P045L17,   P082F22,   P244C01,   P176O07,   P067O14,   P143C19,   P174N09,   P250I18,   P065M23,   P099O24,   P103A09,   P280F08,   P323K03,   P081J15,   P115D10

 Non-Plausible BAC matches

P284G03,   P250J14,   P161D15,   P077K10,   P170B06,   P165F11,   P250I15,   P116G09,   P028D05,   P076F20,   P275A18,   P244O09,   P162B16,   P080C23,   P113D16,   P108N23,   P054F10,   P010L09,   P031K11,   P161D16,   P271K19,   P142N06,   P030F10,   P077F10,   P163M15,   P137A03,   P142J15,   P166L04,   P128E10,   P076M13,   P026G09,   P050H06,   P176J15,   P108K21,   P082G20,   P044H11,   P137C03,   P170B07,   P098C19,   P249H24,   P289J20,   P108F01,   P296I22,   P122C17

 Overgo Sequences

A sequence
AAGGCACTGCTATTCGACTGCGAT
B sequence
TATCGACAAGTACGCCATCGCAGT
AB sequence
AAGGCACTGCTATTCGACTGCGATGGCGTA
Marker sequence
CAAGACGAGTAGGCGTAGTGGAGTAGTGACATGTTCTGCTTCGGTCCTCC
CAAAGGCACTGCTATTCGACTGCGATGGCGTACTTGTCGATACTGAAAAA
GAAGGGCATCGGATCTCTTTCAATGATACCTTTTCTGAGAAGGAATTGGG
TGTAACTTGGGATGTTGATTTGTATGGAGAATTACTCAAAATTGGAGGTG
GAAAAGAAAGGATGACAGCCTACTTTAACAAAATAGGTTGGCCAGAAAAT
GC
Genomic location of T0772  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1596 marker 1596
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)