SGN Marker T0774

SGN-M1597
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAI76TH
Arabidopsis best BAC match: AC009991.3
Arabidopsis position: 3.0150000
Arabidopsis identities: 0.646
Best GenBank protein hit: AAF01523.1
Evalue: 9.9e-42
Identities: 0.566
Description: unknown protein [Arabidopsis thaliana]
Comment: 4.00e-32 match with emb|CAA01494.1| (A20297) wun1 [Solanum tuberosum]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39431)
Chromosome
6
Position
18.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0774 was used as an overgo probe on plate 2 [well C9]

Plausible BAC Matches:   P302A23

 Overgo Sequences

A sequence
CTCGCCCTATATGAAGCTTTGAGC
B sequence
TGTCAACGTCACGTGAGCTCAAAG
AB sequence
CTCGCCCTATATGAAGCTTTGAGCTCACGT
Marker sequence
TAAATATCTCCTCAACTGGCTAATTCTCAGGAAATTCTGGAAGAAACTAG
AAATAAAGGGGTGGTGCTCGCCCTATATGAAGCTTTGAGCTCACGTGACG
TTGACAAGGTCCAGAAACTTCTGGCCTCTGACCTTGAGTGGTGGTTCCAT
GGTCCACCTTCACATCAATTTTTGATGCGCATACTAACTGGTACTGCCAA
CTCCGATCACTATTTCTTCAAATTCATTCCTCAAAGTGTTGACGCCTTTG
GATCTACTGTCCTTGTCGAAGGTTGCGATCCTGATCACTCAATTACTTGG
GTTCACGCTTGGACTGTTGATGATGGGATAATTACTCAGGTTAGGGAGTA
TTTCAATACCTCTCTCACAGTCACTCGACTTGACAATAGTAATAATAATA
ATAATTGCCCTTCATCGGATTTGTCTTCCATTGCTGCTACACGGCATTGC
CCTTCTCTTTGGGAGAGTAGTTTACCTAATCGGGTGGGTAAGTCGGTTCC
GGGTCTTGTTCTCGCTCTCTGAGTTCCGCCAGGATGTAAGTTTTTAACGG
TTGATTTGGGGGTTTTCGTCGCATTGTTTTGATTTTATTATCTGCAATTT
TAATTTGGGACCATGAGGAATGGGATATCC
Genomic location of T0774  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1597 marker 1597
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)