SGN Marker T0778

SGN-M1599
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEAL73TH
Arabidopsis best BAC match: AC007576.3
Arabidopsis position: 1.0375700
Arabidopsis identities: 0.604
Best GenBank protein hit: AAC49566.1
Evalue: 1.0e-28
Identities: 0.753
Description: "ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase [Nicotiana tabacum]"
Comment: enzyme catalyzes the posttranslational methylation of the epsilon-amino group of Lys-14 in the LS of Rubisco
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39858)
Chromosome
5
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0778 was used as an overgo probe on plate 12 [well H9]

Plausible BAC Matches:   P167M10,   P251N01,   P103K01,   P223D23,   P297D09,   P144P09,   P206A16,   P206G13,   P027H13,   P288N08,   P252H03,   P027E06,   P048E10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCAGAACCAGTCCAAACATTCTGG
B sequence
CATCACATAGCCACTTCCAGAATG
AB sequence
CCAGAACCAGTCCAAACATTCTGGAAGTGG
Marker sequence
TGGAAATCTAGTTACTCTGAAATCCAGTAGAACCAAGCTAAGCTAGAAAA
AATGGCTTCTGTTTTCTCTTTACCCTCTTCATCTTTCCTCTGTCCACTCA
AAACCACAAGATTCAGAACAAAGATTCAATCTTTACACAGTTCCCCAAAA
TCACTCTTGATAAACTCTCTTCAGTTGCAAGAACTTGACCCAAATATCCC
AGAACCAGTCCAAACATTCTGGAAGTGGCTATGTGATGAAGGAGTTGTAT
CAGCAAAGACACCTGTAAAGCCAGGAATTGTACCAGAAGGTTTAGGGTTA
GTTGCTAAGAGAGATATAGCTAAAGGGGAGACAGCTCTAG
Genomic location of T0778  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1599 marker 1599
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)