SGN Marker CD32

SGN-M160

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGGGGGGGGGGGGGGGGAAAAAAACCCAAAGGGAGGGGTTTTTTTTAAACCCCCCGGGGGCCCCCAAGGGATTTTGGGGGGGGAAGGG
GGGGGGGAAAAATTTTTTCCCGGGCCCCCTGGGGGGGGGGGCCCCCCCCCCCCCTTTTTATTTCCCAAAAAACCCCCCCCCGGGTTTTAA
AAACCCCCCTTTGGGCAAAAAATTGGGGGGGTTTCAAATTTGCCCCGGTTTTAGGGAAAAAATTTTGTTTTCCCCCCCCAAAAAATTTTT
TGGATTTCCCCCAAACAGGGGCCCCCCCCTTTTGGGGGGGGGGGGGGGGAAAAGGCCAGGGAAAATTCTCCCAGGGGGGGTTTTTTTCAA
AAAAAGGGGAAACCCCCCCCTTTTTTGGGGGGCCCGAAAATTTGAAAAGGG
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51706)
Chromosome
9
Position
40.83 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51707)
Chromosome
10
Position
62.01 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51708)
Chromosome
10
Position
66.19 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49310)
Chromosome
10
Position
51.89 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Eggplant-COSII   
Map version
63 (location: 42278)
Chromosome
10
Position
93.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41564)
Chromosome
10
Position
77.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38934)
Chromosome
9
Position
44.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38935)
Chromosome
10
Position
86.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8365)
Chromosome
9
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 8360)
Chromosome
10
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8358)
Chromosome
9
Position
44.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8359)
Chromosome
10
Position
90.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8369)
Chromosome
9
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8371)
Chromosome
10
Position
17.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8370)
Chromosome
10
Position
30.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
C


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8368)
Chromosome
9
Position
40.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CD32 was used as an overgo probe on plate 3 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAAAGGCCAGGGAAAATTCTCCC
B sequence
GAAAAAAACCCCCCCTGGGAGAAT
AB sequence
GAAAAGGCCAGGGAAAATTCTCCCAGGGGG
Marker sequence
GGGGGGGGGGGGGGGGGGGAAAAAAACCCAAAGGGAGGGGTTTTTTTTAA
ACCCCCCGGGGGCCCCCAAGGGATTTTGGGGGGGGAAGGGGGGGGGGAAA
AATTTTTTCCCGGGCCCCCTGGGGGGGGGGGCCCCCCCCCCCCCTTTTTA
TTTCCCAAAAAACCCCCCCCCGGGTTTTAAAAACCCCCCTTTGGGCAAAA
AATTGGGGGGGTTTCAAATTTGCCCCGGTTTTAGGGAAAAAATTTTGTTT
TCCCCCCCCAAAAAATTTTTTGGATTTCCCCCAAACAGGGGCCCCCCCCT
TTTGGGGGGGGGGGGGGGGAAAAGGCCAGGGAAAATTCTCCCAGGGGGGG
TTTTTTTCAAAAAAAGGGGAAACCCCCCCCTTTTTTGGGGGGCCCGAAAA
TTTGAAAAGGG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CD32  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D160 marker 160
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)