SGN Marker T0787

SGN-M1603
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAK92TH
Arabidopsis best BAC match: AC005990.1
Arabidopsis position: 1.0530000
Arabidopsis identities: 0.761
Best GenBank protein hit: CAB79646.1
Evalue: 1.9e-43
Identities: 0.674
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40815)
Chromosome
10
Position
9.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39861)
Chromosome
10
Position
19.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0787 was used as an overgo probe on plate 16 [well A5]

Plausible BAC Matches:   P328L08,   P305L17,   P164K03

 Overgo Sequences

A sequence
CAGTACAGCGACAACTTCCGAGAA
B sequence
AAACACCGGCTTCTTCTTCTCGGA
AB sequence
CAGTACAGCGACAACTTCCGAGAAGAAGAA
Marker sequence
CGGCAACCAGTACAGCGACAACTTCCGAGAAGAAGAAGCCGGTGTTTGTC
AAAGTGGAAAGCCTAAAACCTGGAACACATGGTCATAATTTGACGGTTAA
AGTTGTTGAATCGAACACTGTCAAGGCCACCGGCGGCGGCGGCCGTGGTG
GCAGAGTATCGGCGTCGTTAAATTCTCGTGCTCCACCACGGATCTCCGAG
TGCCTCATCGGTGATGAGACAGGGTCCATCCTCTTCACTGCTCGCAACGA
ACAGGTTGATTTAATGAAGCCAGGTGCTACTGTGATTCTGAGGAACGCAA
AGATTGACATGTTCAAGGGTTCCATGCGGCTTGCAGTAGACAAATGGGGC
CGCGTTGAGATTACTGAACCTGCTGATATTGCTGTTAACGATCAAAACAA
CCTTTCTTTAGTCGAGTATGAGTTGGTGAATGTTGATGAGTAGAGGGAAC
TAATTAATAGCTCGGTAGTTTTAAGTTGTCGAGTCCAATTCTTGGTTTAT
TTGTTAATTATTGCATTCCTTGAATTTTATGTGCCAGAATGACAGCATTT
CAGCCCTTATAATATG
Genomic location of T0787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1603 marker 1603
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)