SGN Marker T0796

SGN-M1607
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAZ34TH
Arabidopsis best BAC match: AC011717.4
Arabidopsis position: 1.1541000
Arabidopsis identities: 0.774
Best GenBank protein hit: AAF09059.1
Evalue: 1.9e-91
Identities: 0.769
Description: putative D-isomer specific 2-hydroxyacid dehydrogenase; [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39435)
Chromosome
3
Position
157.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0796 was used as an overgo probe on plate 6 [well B9]

Plausible BAC Matches:   P043F15,   P176M23,   P210F21,   P159A22,   P314G14,   P177L08,   P237F21,   P080K04

 Overgo Sequences

A sequence
GCGATTCAAGCTCTTCCGATTCTG
B sequence
CTTCTGCGGAACATTCCAGAATCG
AB sequence
GCGATTCAAGCTCTTCCGATTCTGGAATGT
Marker sequence
TGGAAAGCATCGGAGTATTGATGGCCTGTCCTATGTCATCTTACCTAGAA
CAAGAGCTAGATAAGCGATTCAAGCTCTTCCGATTCTGGAATGTTCCGCA
GAAGAATGAATTCCTCAGTCAGCACGCTGATTCCATCCGTGCTGTCGTCG
GCAACGCATTCGCCGGCGCTGACGCTGAGCTCATCAATTCCCTCCCTAAG
CTCGAGATTGTTTCGAGTTTCAGTGTTGGTTTAGATAAGATTGATTTGAA
CAAGTGTAAAGAGAAGGGGATTAGGGTTACTAATACTCCCGATGTTTTGA
CTGAGGACGTGGCTGATTTGGCTATAGGGTTGATGTTGGCCGTCCTCAGG
AGGATTTGCGAATGCGATCGACATGTTAGGAAAGGGCTGTGGAAGAGCGG
TGATTTCAAGTTGACTTCTAAGTTTAGTGGCAAATCAGTGGGTATTATAG
GATTGGGAAGGATTGGATTGGCAATTGCTAAGAGAGCGGAGGCTTTTGGC
TGTCCAATTAGTTACTACACGAGATCAGAAAAGCCAAATACAAATTATAA
GTATTATCCAAGTGTAGTTGAGTTGGCTTCCAATTGCCAGATTCTGGTTG
TGGCATGTGCACTGACTCCTGAGACTCGTCATATTGTCAACCGTGAGGTC
ATGGAAGCTTTGGGATCAAAAGGAATTCTGATTAACATTGGGCCGTGGTC
CTCATGTTGATG
Genomic location of T0796  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1607 marker 1607
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)