SGN Marker T0798

SGN-M1608
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TMEBB27TH
Arabidopsis best BAC match: AB010068.1
Arabidopsis position: 5.0490000
Arabidopsis identities: 0.622
Best GenBank protein hit: BAB11201.1
Evalue: 1.0e-48
Identities: 0.691
Description: contains similarity to ribosomal protein 30S subunit~gene_id:T31K7.7 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39862)
Chromosome
6
Position
69.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0798 was used as an overgo probe on plate 5 [well G8]

Plausible BAC Matches:   P306N20,   P188G21,   P226P09,   P108E01,   P093G12,   P274E15,   P246N01,   P304I22

 Overgo Sequences

A sequence
TGGATGTTAGGCTGTCTGTTCGAG
B sequence
TTTCCAAGCTCTCCACCTCGAACA
AB sequence
TGGATGTTAGGCTGTCTGTTCGAGGTGGAG
Marker sequence
CTGCTGTAAAGGACTATGTGGAAGAGAAGTTGGGTAAGGCAGTTCAAAAG
CACAGCCATCTAGCCAGGGAAGTGGATGTTAGGCTGTCTGTTCGAGGTGG
AGAGCTTGGAAAAGGCCCAAAAATTCGAAGATGTGAAGTTACTCTATTTA
CGAAAAAGCATGGAGTGATTCGTGCAGAGGAAGACGGTGAGTCAATTTAT
GGAAGTATAGATATGGTATCATCAATTATACAGAGAAAGTTGCGGAAAAT
TAAGGAGAAGGATTCAGACCGTGGTCGCCACATGAAGGGCTTCGATAGGC
TGAAAGTCAGGGACCCAGAGGCGCTGTTAGTTCAAGAGGATCTTGAAACA
CTTTCCCAAGAGGAAGAAGTTGAAGATGACAAGAGTGATGGCTTTGTTAC
TGAGGGTTG
Genomic location of T0798  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1608 marker 1608
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)