SGN Marker T0800

SGN-M1609
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TMEBA32TH
Arabidopsis best BAC match: AC007209.5
Arabidopsis position: 2.0750000
Arabidopsis identities: 0.918
Best GenBank protein hit: AAD28669.1
Evalue: 4.8e-83
Identities: 0.870
Description: alanine-glyoxylate aminotransferase [Arabidopsis thaliana]
Comment: function not well characterized in plants
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53504)
Chromosome
12
Position
77.95 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Pepper-COSII   
Map version
58 (location: 41621)
Chromosome
12
Position
120.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43589
Forward primer (5'-3')
GCCTCGAAAATTGCAGAAGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCGTGTCTTGCAATCACATT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39436)
Chromosome
12
Position
118.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35594
Forward primer (5'-3')
GCCTCGAAAATTGCAGAAGA
Digested band sizes (using RV)
Solanum pennellii LA716: 180+420
Solanum lycopersicum LA925: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCGTGTCTTGCAATCACATT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 155
Forward primer (5'-3')
Unknown
Digested band sizes (using RV)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 180+420
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0800 was used as an overgo probe on plate 4 [well C2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACCATCAAGGCGGTTTGCATTGTG
B sequence
TGGCTGTCTCGTTATGCACAATGC
AB sequence
ACCATCAAGGCGGTTTGCATTGTGCATAAC
Marker sequence
GCAAATCTTGAGGTTTTGGCCTCGAAAATTGCAGAAGATAAGTCTCATAC
CATCAAGGCGGTTTGCATTGTGCATAACGAGACAGCCACTGGAGTTACCA
ACAACTTGGCTACTGTAAGGAAAATACTCGATCACTACCAGCATCCTGCC
CTCTTCCTTGTTGATGGAGTGTCCTCAATTTGTGCACTTGATTTCCGTAT
GGACGAATGGGGTGTAGATGTGGCACTTACTGGTTCCCAAAAAGCACTTT
CCCTTCCCACGGGGCTCGGGATAGTCTGTGCTAGCCCCAAGGCTCTTGAG
GCCAGCAAAACTGCAAAATCAGTGAGAGTTTTCTTTGACTGGAGTGATTA
CCTTAAGTTCTACAAGCTGGGAACTTATTGGCCGTATACTCCTTCCATCC
AACTTTTGTATGGTCTGAGAGCAGCTCTCGACCTTCTTTTCGAGGAAGGC
CTTGATAATGTGATTGCAAGACACGCTCGCCTTGGCAAAGCAACAAGACT
TGCTGTGGAGGCATGGGGCTTGAAGAACTGCACT
Genomic location of T0800  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1609 marker 1609
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)