SGN Marker CD34

SGN-M161

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD34 image not available
Forward sequence
not available
Reverse sequence
GTCAGAAAAACCAAATAGAAAAAACAACCTCTCAGAAACAGATTAAGATCAATATCCTCCCTTCAAATCATTAACCACATCATATGGTAT
GGGGGTAACTGTCTCCAGAGTAGCACCTTCAACCATGAACCCTGGTTTGGGTCCTAGTGGTTGCCTTTTTGTGCTGATGACTTCTCCTCT
AGCCTTGGCGTCAGCCTTAAGTTGGTCATTCTTCTTGATCCTTTCCCTGACTTCTTCGGTGCATCGAGATTGCTGGACATGCTCAATCCT
CACATGGATCCTCTTTCTTAAGATCTTGTTACGAACCTGCTTGTTGACTTCAACACCAACGGCGCGTTTGGTAACATTCCAAACACGACC
AGTACGTCCATGGTAGAACTTGTGAGGCATTCCCTTGTGAATAGCACCATTCACCTTGATATCAACATAATCTCCGATTTTGAAAATCCT
CAAGTAGGTCGAAAGTGCGATGGTACCCTTCTTCCTGAAGGCGCGAGAGAATGAATCTCTCG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1607766e-115208 (40.6% of RFLP seq)-
SGN-U1438006e-118477 (93.2% of RFLP seq)-
SGN-U143799511 (99.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53433)
Chromosome
10
Position
35.75 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51709)
Chromosome
10
Position
84.36 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8372)
Chromosome
10
Position
62.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8373)
Chromosome
10
Position
52.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8374)
Chromosome
10
Position
44.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD34 was used as an overgo probe on plate 14 [well C6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGTCTCCAGAGTAGCACCTTCAAC
B sequence
CAAACCAGGGTTCATGGTTGAAGG
AB sequence
TGTCTCCAGAGTAGCACCTTCAACCATGAA
Marker sequence
GTCAGAAAAACCAAATAGAAAAAACAACCTCTCAGAAACAGATTAAGATC
AATATCCTCCCTTCAAATCATTAACCACATCATATGGTATGGGGGTAACT
GTCTCCAGAGTAGCACCTTCAACCATGAACCCTGGTTTGGGTCCTAGTGG
TTGCCTTTTTGTGCTGATGACTTCTCCTCTAGCCTTGGCGTCAGCCTTAA
GTTGGTCATTCTTCTTGATCCTTTCCCTGACTTCTTCGGTGCATCGAGAT
TGCTGGACATGCTCAATCCTCACATGGATCCTCTTTCTTAAGATCTTGTT
ACGAACCTGCTTGTTGACTTCAACACCAACGGCGCGTTTGGTAACATTCC
AAACACGACCAGTACGTCCATGGTAGAACTTGTGAGGCATTCCCTTGTGA
ATAGCACCATTCACCTTGATATCAACATAATCTCCGATTTTGAAAATCCT
CAAGTAGGTCGAAAGTGCGATGGTACCCTTCTTCCTGAAGGCGCGAGAGA
ATGAATCTCTCG
Genomic location of CD34  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D161 marker 161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)