SGN Marker T0801

SGN-M1610
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TMEAZ44TH
Arabidopsis best BAC match: AC025781.6
Arabidopsis position: 1.0771000
Arabidopsis identities: 0.690
Best GenBank protein hit: AAB42144.1
Evalue: 6.2e-86
Identities: 0.669
Description: acetyl-CoA carboxylase [Medicago sativa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49561)
Chromosome
12
Position
48.36 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47495)
Chromosome
12
Position
72.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42397)
Chromosome
5
Position
80.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41622)
Chromosome
12
Position
58.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43590
Forward primer (5'-3')
ATTTTCAGGTGGACAGAGGGATCT
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AATGATTGCTGACAGGTTACGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39437)
Chromosome
12
Position
74.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10925)
Chromosome
5
Position
80.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Other PCR data 
PCR data   Exp. ID 35595
Forward primer (5'-3')
GAGCCGGAAGGTATGATTGA
Digested band sizes (using AccI)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GACCTTGTGGTAGGGCATGT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 589
Solanum lycopersicum LA925: 589
Approximate temperature
55°C
  
PCR data   Exp. ID 153
Forward primer (5'-3')
Unknown
Digested band sizes (using AccI)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 589
Solanum lycopersicum LA925: 589
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0801 was used as an overgo probe on plate 4 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAACCCGTGAGACACAGCTTTTGC
B sequence
ATCTGCGTGTATACGGGCAAAAGC
AB sequence
AAACCCGTGAGACACAGCTTTTGCCCGTAT
Marker sequence
TGGTTGTGGACAGTAAGATCAATTCAGACCACATCGAAATGTATGCGGAA
CGGACAGCCAGGGGAAATGTCCTTGAGCCGGAAGGTATGATTGAAATTAG
ATTCAGAACAAAAGAACAGCTCGAGTGCATGGGTAGGACTGACCAACAGC
TTATCAATCTCAAGTCAAAGCTTCAGGAAGCCAAGACCGCAGGGGTATAC
GCTAATGTTGATGCCCTAGTGAAGCAAATTAAAACCCGTGAGACACAGCT
TTTGCCCGTATACACGCAGATAGCTACAAAGTTTGCAGAGTTACATGATA
CTTCGTCAAGAATGGCGTCCACGGGGGTGATCCGTAAAATAGTAGATTGG
GAAACTTCTCGTTCATTCTTTTACGGACGTCTGCTTCGAAGAGTAGAGGA
GGAAATGTTGGTCAAAACTGTGAGGAATGCTGCTGGTGACCAGCTTTCTT
ATAAATCTGCTATGGGTATGGTGAAAAGCTGGTTTTTGGATTCAAAACAA
GGCAATGTAGATGCTTGGATCGATGATGAAGCCTTTTTCTCATGGAAGAA
TGACCCCAAGAACTATGAAGAACAACTACAAGAATTGCGGGTGCAAAAGG
TACTACTTCAGCTATCGAAGATTGGTGATTCGACATTGGATTTACATGCC
CTACCACAAGGTCTTCTTTCCCTCCTACAGAAGGTCGAGCCAGCAACACG
AGAA
Genomic location of T0801  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1610 marker 1610
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)