SGN Marker T0802

SGN-M1611
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.01
Tomato EST read: TMEBA37TH
Arabidopsis best BAC match: AC012654.2
Arabidopsis position: 1.1395000
Arabidopsis identities: 0.755
Best GenBank protein hit: CAA64565.1
Evalue: 1.3e-78
Identities: 0.993
Description: LRR protein [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39863)
Chromosome
10
Position
58.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0802 was used as an overgo probe on plate 16 [well A6]

Plausible BAC Matches:   P256L16,   P153E06

 Overgo Sequences

A sequence
TATCTGACCCGGGTAACGTGTTAC
B sequence
TTTGGATCCCAGCTCTGTAACACG
AB sequence
TATCTGACCCGGGTAACGTGTTACAGAGCT
Marker sequence
ACACTCACCACCTGTTGTCATTCCCAAAATCCAACCTTTTTACTCCTACT
TTCCTCTATATTTCTTCCTTCTTCTTCTCCAAAAAAAATTCTCCATAAAA
TTCTAAGCAAAACCCATAAATTTTCTTTGATTTTTGAGTATTAATAACCA
TGGAAGCTGTGTTCAAAACCCAGAGTTTGTTCTTGAAGTTATGGGGTTTG
TTGGCAGTTGTTCTTGCTGTAGCTGTGGCTGTAAAGGGGAATTCAGAAGG
GGATGCTTTGTACGCCCTCCGCCGGAGCTTATCTGACCCGGGTAACGTGT
TACAGAGCTGGGATCCAAATCTTGTTAACCCTTGTACCTGGTTTCATGTC
ACTTGCAACGGAGATAATCAAGTTACTCGTGTGGATCTTGGGAACTCAAA
GTTATCTGGTCATTTGGTACCTGAGCTCGGAAAGCTTGAACATCTACAGT
ATCTGGAGCTTTACAAAAATAATATTCAGGGAACCATCCCTAAAGAGCTC
GGTAACTTGAAGAGCCTTATTAGTCTGGATCTGTACAACAACAATATTTC
GGGGACAATTCCTACTTCACTTGGAAACCTGAAAAACCTTGGTTTCTTGC
GTCTAAATGATAACAAGCT
Genomic location of T0802  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1611 marker 1611
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)