SGN Marker T0805

SGN-M1614
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.03
Tomato EST read: TMEBA54TH
Arabidopsis best BAC match: AL021811.1
Arabidopsis position: 4.1640000
Arabidopsis identities: 0.682
Best GenBank protein hit: CAA50520.1
Evalue: 4.2e-28
Identities: 0.811
Description: CF(o)II ATP synthase subunit 9 [Spinacia oleracea]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39865)
Chromosome
6
Position
43.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0805 was used as an overgo probe on plate 5 [well A7]

Plausible BAC Matches:   P260C02,   P026J12,   P324A02,   P330C17,   P044J22

 Non-Plausible BAC matches

P233H10,   P176G01,   P315I14,   P033M17

 Overgo Sequences

A sequence
GCTGAAGTGAAGCAACTGGAAGAC
B sequence
TAATTGCAGCAGCCTGGTCTTCCA
AB sequence
GCTGAAGTGAAGCAACTGGAAGACCAGGCT
Marker sequence
GCCATGGCCAACATGATGATGAGCTCCTCCAAAGTTTTAATCACTTCTTC
ATCCTCCACCATCCCTCCATCACCAAGATTCAAACTTTCCCTCACCCAAA
TCCCTTTTCCAAAACTACCCCTCCCCAAATCACCCAAATCCCTTGAAACC
CTTTCAATCCCATCAACTCTCAAGTCCATTTCTGTCATTCTTGCAAGCTC
ATTGGCCATGGCACCACCTTCGCTAGCAGAGGAAATTGAAAAAGCTTCCC
TTTGTGACTTCAACTTGACACTCCCAATCATGATGGCTGAATTCCTCTTT
CTCATGTTAGCTTTAGACAAGATTTACTTCAGCCCATTAGGGAAATTCAT
GGATGAAAGAGATTCTGCCATTAAGGAGAAATTGAGCAGTGTGAAGGACA
CCTCTGCTGAAGTGAAGCAACTGGAAGACCAGGCTGCTGCAATTATGAAG
GCTGCAAGGGCTGAGATATCAGCAGCATTGAACAAGATGAAGAAAGAGAC
TCAGCAAGAAGTAGAGCAGAAGATTGCAGAAGGAAGGAAGAAAGTTGAGG
CTGAATTGCAAGAAGCTTTGGCTAGCTTAGAGAGTCAAAA
Genomic location of T0805  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1614 marker 1614
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)