SGN Marker T0814

SGN-M1618
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBB75TH
Arabidopsis best BAC match: AC000098.1
Arabidopsis position: 1.0130000
Arabidopsis identities: 0.682
Best GenBank protein hit: AAB71459.1
Evalue: 4.4e-47
Identities: 0.758
Description: Similar to Mycobacterium RlpF [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42398)
Chromosome
5
Position
128.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39866)
Chromosome
12
Position
116.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10941)
Chromosome
5
Position
129.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0814 was used as an overgo probe on plate 3 [well E11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTCAGAAAAGCCATGGAGACAAG
B sequence
CTCTTGATTAGCGCGTCTTGTCTC
AB sequence
GGTCAGAAAAGCCATGGAGACAAGACGCGC
Marker sequence
TGAGTAGCTCTTCACTCACAGCTTCTTTACATGCCAGCACTTTGCGGTCT
CCTTTTGTTGGGAGTTTGAATGGGTTTCATGTATCGAGTGTTGCTGTTCG
CCGTGTTGGTTTTGTGAGTAAGACGGTCGAATGTAAAGAATCAAGAATCG
GGAAGCAACCAATATCAGTACCTTCAAATGTGACACTCACAATGGAAGGC
CAAGATTTGAAAGTTAAGGGACCTCTGGGGGAGATGGCCATAACTTATCC
ACGAGAAGTAAAGCTTGAGAAGGAAGATGGAGGTATTCTAAGGGTCAGAA
AAGCCATGGAGACAAGACGCGCTAATCAAGAGCATGGTTTATTCAGGACT
CTAACTGATAACATGGTAGTCGGCGTTTCCAAAGGATTCGAGAAGAAACT
TCAATTGGTAGGGG
Genomic location of T0814  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1618 marker 1618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)