Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0834

SGN-M1628
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.04
Tomato EST read: TMEBE33TH
Arabidopsis best BAC match: AB026651.1
Arabidopsis position: 5.1430000
Arabidopsis identities: 0.692
Best GenBank protein hit: AAF27046.1
Evalue: 1.3e-57
Identities: 0.577
Description: AtCLH2 [Arabidopsis thaliana]
Comment: "chlorophyllase,key enzyme in chlorophyll degradation"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39444)
Chromosome
6
Position
32.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35596
Forward primer (5'-3')
TAATTGGGACCCCATCAGAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCCTTTAGGAGCACAAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 800
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T0834 was used as an overgo probe on plate 4 [well B10]

Plausible BAC Matches:   P307J13,   P301C21,   P053B14

 Overgo Sequences

A sequence
TTCAGCGTTGATCGGTGTTGATCC
B sequence
CTCCATTCCATCCACAGGATCAAC
AB sequence
TTCAGCGTTGATCGGTGTTGATCCTGTGGA
Marker sequence
GATATTGGAAATTACAAGACTAAGCTATTGAAAATCGAGCCACAAACATG
TAGCAAACACAATTCTCCTCCAAAATCTCTGTTAATTGGGACCCCATCAG
AAGCAGGAAACTTCCCAGTATTGATATTTCTCCATGGCTATCTTCTTTAC
AATTCTTTCTATTCACAACTTATTCAACATCTCTCTTCTCATGGCTTCAT
TGTTGTTGCTCCTCAGTTATATTTAGTGGAAGGAGCAGATGCAACCGAGG
ATATCAAATCGACAGCTGAAGTCACCCATTGGTTATCTGAAGGATTGCAG
CATCACCTTCCACCTGATGTTGAGCCAAACTTGACGAAACTTGGACTAGC
AGGCCATAGCCGTGGGGGAAAAGTTGCATTTTCGCTAGCTCTTGGTAGAC
TTGCTAGTGACCTGAAATTTTCAGCGTTGATCGGTGTTGATCCTGTGGAT
GGAATGGAGAAAGGAAAGCAAACTCCGCCATCAGTTCTCACCTACGTTCC
GCGTTCCTTCATTAATCTTGATATCCCTGTGATGGTAATTGGCTCGGGTT
TGGGAGAAGTT
Genomic location of T0834  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1628 marker 1628
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)