SGN Marker T0846

SGN-M1631
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TMEBC63TH
Arabidopsis best BAC match: AL022198.1
Arabidopsis position: 4.1570000
Arabidopsis identities: 0.735
Best GenBank protein hit: AAA50157.1
Evalue: 2.0e-82
Identities: 0.867
Description: omega-6 desaturase [Brassica napus]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39869)
Chromosome
7
Position
0.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0846 was used as an overgo probe on plate 7 [well B12]

Plausible BAC Matches:   P217L02,   P162H24,   P032A24,   P111F22,   P136E10

 Overgo Sequences

A sequence
ATGCCTGACTACGCTTGATTAGCG
B sequence
GACCTTTTGAGGTGCACGCTAATC
AB sequence
ATGCCTGACTACGCTTGATTAGCGTGCACC
Marker sequence
TCGGCTGGCCACTGATAATCTGGAAAACAGGGATTATTGGATGGATCAAG
TTCTGGTTAATGCCATGGTTGGGTTATCATTTTTGGATGAGTACTTTTAC
AATGGTTCATCATACGGCTCCCCACATACCCTTCAAAACTTCTGATGAGT
GGAATGCTGCTCAGGCCCAGCTGAATGGCACAGTTCACTGTGACTATCCT
AGTTGGATTGAGGTTCTTTGTCATGATATCAATGTTCATATTCCCCACCA
CATATCCCCCAGAATACCAAGTTATAATTTACGGGCAGCTCATCAATCTC
TCCAAGAGAATTGGGGAAAGTACCTTAACGAGGCTTCATGGAACTGGCGT
CTAATGAAGACAATACTGACAGTATGTCATGTCTATGATAAGGAGCGGAA
TTATGTTCCATTTGATGAAATTGTCCCCGAAGAAGCCAAGCCAATCACAT
TCCTTAAAAAAGTAATGCCTGACTACGCTTGATTAGCGTGCACCTCAAAA
GGTCAATTTTCACTTGCTTCATTCTTTGGGAAGATATCCTTTCAATCCTA
TTGGGTCCGGTCAAGGGCCCAAATGTCAAGTTCTCACAAATATTGTAAGA
CTTGTTTTAACACATTAAAGAGAGAAATATCTTCTC
Genomic location of T0846  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1631 marker 1631
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)