SGN Marker T0848

SGN-M1633
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBC67TH
Arabidopsis best BAC match: AC013483.5
Arabidopsis position: 3.0121000
Arabidopsis identities: 0.661
Best GenBank protein hit: AAF21178.1
Evalue: 3.2e-65
Identities: 0.678
Description: putative coated vesicle membrane protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49563)
Chromosome
7
Position
64.57 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47497)
Chromosome
7
Position
89.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39445)
Chromosome
7
Position
92.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0848 was used as an overgo probe on plate 8 [well B5]

Plausible BAC Matches:   P076B20,   P199G09,   P315O15,   P141K10,   P094P03,   P302J11,   P309B15

 Overgo Sequences

A sequence
ATGCTGCCCACTTCTTATACCACG
B sequence
TCTTTTGCGTGCTCGTCGTGGTAT
AB sequence
ATGCTGCCCACTTCTTATACCACGACGAGC
Marker sequence
TCGTACAAATTTCAAACTCTTGTCCAAAATCCCAATTTTTTCGCCAAGAA
AAGATGAGAATTGGGTCATTGAAAGTTTGGATCTTGGTGACTATATTGGT
GGTGGCATGGAGATGTGGAGGGGTTTATGGAATTAGATTTGTGATTGATA
GAGAAGAATGTTTTTCACATAAAGTTCAAATGGGAGAATCAGTCCATTTT
TCGTTTGTTGTTATCAAATCAGAAGGTTCTTGGCATTATAGTGAAGAGGG
TGTTGACCTTGTGGTGAAGGGACCTTCCGGGGAGCAGCTTCATGATTTTC
GTGACAAAATAAGTGAGAAGAACGAGTTTGTGGCCCATCATGAAGGAGTT
TATCGTTTCTGTTTCACCAACAGGTCACCCTATCATGAAACCATAGACTT
TGATCTACATGCTGCCCACTTCTTATACCACGACGAGCACGCAAAAGATG
AGCATTTCAAACCGTTGTTTGAGCACATTGGACAACTAGAGGAAGCTTTA
TACAACATTCAGTTTGAGCAGCATTGGCTCGAGGCCCAGACAGACCGACA
GGCCATAGTGAATGAAATAATGAGCAAAAG
Genomic location of T0848  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1633 marker 1633
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)