SGN Marker T0863

SGN-M1640
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAM20TH
Arabidopsis best BAC match: AC006922.6
Arabidopsis position: 2.2020000
Arabidopsis identities: 0.682
Best GenBank protein hit: AAD31578.1
Evalue: 3.3e-27
Identities: 0.809
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39448)
Chromosome
9
Position
12.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0863 was used as an overgo probe on plate 1 [well A9]

Plausible BAC Matches:   P066K12,   P066J09

 Overgo Sequences

A sequence
TCGCAGAGAGGGAAAAAATGGGAG
B sequence
CTGTGAGGACACTTTCCTCCCATT
AB sequence
TCGCAGAGAGGGAAAAAATGGGAGGAAAGT
Marker sequence
TTCCCAATCCAATCGGTAAAACCCTAATTCGCAGAGAGGGAAAAAATGGG
AGGAAAGTGTCCTCACAGGAGCGTGAAGAAGCGTAGATACTCTCACAAGC
AGTTTCGCCGTGCGAAATTCCTTGTCAAAGGAGACGATGCTGTTTACGAT
GAGCTGTTAAAGCCGGAGGAGCAACGGAAAGAGTTGCCCGTCGACGAAGA
TCTTCCCGGAATGGGTCAATACTACTGTATGCACTGCGATCGATATTTTG
CAAATGTTACTGTGAGGGATGAGCATTTCAAGACGAAGAAGCACAGGAAG
CGTGTGAAAATAATGATGGGCCCTCGACCGCACACCCAACTTGATGCCGA
CTTAGCTGCTGGAATGGGCATGCCAGATAATGGTCCAAAGCTAATGTCAA
TGAGTTAGAGCTTCCCCCCTCCTGTTTACAACTCATTTGACACTGGTAGA
GGAACCG
Genomic location of T0863  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1640 marker 1640
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)