SGN Marker T0869

SGN-M1643
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TMEAO32TH
Arabidopsis best BAC match: AC008261.3
Arabidopsis position: 3.0010000
Arabidopsis identities: 0.775
Best GenBank protein hit: AAD31520.2
Evalue: 4.4e-56
Identities: 0.910
Description: cystathionine-gamma-synthase [Solanum tuberosum]
Comment: first step from cysteine to methionine
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49567)
Chromosome
2
Position
39.81 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47501)
Chromosome
2
Position
24.05 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39870)
Chromosome
2
Position
21.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0869 was used as an overgo probe on plate 10 [well F4]

Plausible BAC Matches:   P080J07,   P280E02

 Overgo Sequences

A sequence
GTGGTGTGGTCAGTTTTGAGGTTG
B sequence
GTTAGGAGGTCTCCATCAACCTCA
AB sequence
GTGGTGTGGTCAGTTTTGAGGTTGATGGAG
Marker sequence
GTCATCCGGAATATCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGT
GTGGTCAGTTTTGAGGTTGATGGAGACCTCCTAACTACTGCAAAATTTGT
GGATGCTCTGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGA
ACATTGTGGACCAACCAACAATAATGGCTTATTGGGATCTTAACCAGTCT
GATAGAGCAAAGTATGGCATCTTGGATAACTTGGTCCGATTTAACTTTGG
AGTGGAAGAATTTGAAGATGTGAAAGCTGATGTTCTTCAAGCTTTGGATT
CCATTTAGGCTGGTGTTTCACCTGCAACCGATTTTTTCCTTTTCCTTTTC
ATCCTGATTTCGTTGTTCGTACTTGTGTTATTGCTGACTTCCATCTCGTA
TCCAATTGTTTGAACCTAATTAAAGGATCGTCTAGTAGATGATTCAATCC
ATTAAATTATTTCATGTCGTGTT
Genomic location of T0869  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1643 marker 1643
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)