SGN Marker T0879

SGN-M1650
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TMEAM58TH
Arabidopsis best BAC match: AB024035.1
Arabidopsis position: 5.2380000
Arabidopsis identities: 0.835
Best GenBank protein hit: BAA97032.1
Evalue: 2.2e-69
Identities: 0.835
Description: dbj|BAA97032.1| (AB024035) N-myristoyl transferase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39450)
Chromosome
6
Position
41.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39451)
Chromosome
3
Position
163.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0879 was used as an overgo probe on plate 4 [well H5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P289B15,   P252K09,   P163D14,   P148I16,   P176L18,   P172J04,   P041J08,   P168O02,   P252K21,   P113I05,   P186I08,   P013O07,   P292M03,   P306D06,   P009I09,   P284B07,   P103I23,   P151L05,   P120H21,   P112C24

 Overgo Sequences

A sequence
GAGCCCCATGATGTTCCTGCAGTT
B sequence
TCCTGAGCAATCGAGTAACTGCAG
AB sequence
GAGCCCCATGATGTTCCTGCAGTTACTCGA
Marker sequence
GGAAGATGGAGCCCCATGATGTTCCTGCAGTTACTCGATTGCTCAGGAAT
TACTTGAAGCAGTTTGTGGTTGCACCTGACTTTGATGAAAATGATGTGGA
ACACTGGCTTCTGCCAAAGGAAGGTGTTATTGACAGTTATCTGGTTGAAA
GTCCTCAAACTCATGAAATCACCGACTTCTGCAGTTTTTACACACTCCCT
TCATCAATTCTTGGTAACCAGAATCATACCACTCTAAAAGCTGCTTATTC
GTATTACAATGTCTCTACAAAGACTCCATTGATTCAGTTGATGAATGATG
CCCTTATTGTGGCAAAACAGAAGGACTTTGATGTTTTCAATGCCCTAGAT
GTTATGCAGAACGATAGTTTCTTAAAGGAACTGAAGTTTGGCCCCGGTGA
TGGGAAACTCCACTACTATCTCTACAATTATCGAACAAAGCATGTTNTAA
GATCATCAGAGCTTGGGCTTGTACTCTTGTAGTTGGAGTTCACAAAACTG
TTTGTTACTGGGGACAGAGCAGCA
Genomic location of T0879  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1650 marker 1650
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)