SGN Marker T0880

SGN-M1651
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: None
Arabidopsis best BAC match: AC006921.5
Arabidopsis position: 2.1990000
Arabidopsis identities: 0.784
Best GenBank protein hit: AAD21435.1
Evalue: 1.5e-17
Identities: 0.784
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132214)
Chromosome
9
Position
3.06 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42400)
Chromosome
9
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39452)
Chromosome
9
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 11003)
Chromosome
9
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0880 was used as an overgo probe on plate 15 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTGAGACACAAGGCATCTGCGTT
B sequence
CCATTAAGGTGTGTCCAACGCAGA
AB sequence
GTTGAGACACAAGGCATCTGCGTTGGACAC
Marker sequence
GTCTATGGTATTTTCCTACATGATCCTGTTAGCTTTGCTGCACTAGTTTG
GCCTGAACTTTTCACCTTCAAGAAGGGCGTCGTGAGGGTTGAGACACAAG
GCATCTGCGTTGGACACACCTTAATGGACCAAGGGCTAAAGAAGTGGAAT
ACGAGCAATCCTTGGACAGATTATTCCCCGGTTTCAGTTGCGTGGACAGT
TGATGTGGACGAAGTTCTGGATTATATAAAGAAAACGTTAATGAAACCGT
GATTACCATTGGATTTATCGGTCTCTTCCATGTGTGAATCTGCTCGGGA
Genomic location of T0880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1651 marker 1651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)