SGN Marker T0882

SGN-M1652
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TMEAM70TH
Arabidopsis best BAC match: AC004005.2
Arabidopsis position: 2.2380000
Arabidopsis identities: 0.750
Best GenBank protein hit: AAD44809.1
Evalue: 1.3e-54
Identities: 0.798
Description: "6,7-dimethyl-8-ribityllumazine synthase precursor"
Comment: involved in riboflavin biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49569)
Chromosome
12
Position
63.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47503)
Chromosome
12
Position
96.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39453)
Chromosome
12
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0882 was used as an overgo probe on plate 4 [well D1]

Plausible BAC Matches:   P170B09,   P183B02,   P093P12

 Overgo Sequences

A sequence
TGAATCCTCAGCAGTCTCATCGTC
B sequence
GACAAACTGCAGAGCTGACGATGA
AB sequence
TGAATCCTCAGCAGTCTCATCGTCAGCTCT
Marker sequence
TGGCGGCTTCAGCTTTCGGACAGTGTAGTCTTCTTCCTCGTACAGTATCT
TTGAATCCTCAGCAGTCTCATCGTCAGCTCTGCAGTTTGTCTTTCCATAG
ACAAACTGTAAATTCTTCACTTCCTGCACTGTCATTCACTCAGTCTATAG
GTTTTGGGTCTGCAATTGAGAGACATTGTGTGGATCGAAACGGGTCGGAT
TTGTTTAAAACGGATGCTGTTCGTCAGTTGAATGGTTCAGTTATCTCTGC
TAAGGGGCATCGGTTTGCTATTGTGGTTGCACGTTTTAATGATCTGATCA
CCAAGAAGCTTTTGGAGGGAGCTTTGGAGACTTTCAAGAATTACTCGGTT
AGAGAGGAAGATATTGATGTTGTGTGGGTTCCTGGTTGNTTTGAAATCGG
CGTGACTGCACAGCTTCTTGGNAAGTCACAGAAATATCAC
Genomic location of T0882  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1652 marker 1652
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)