SGN Marker T0888

SGN-M1654
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAO82TH
Arabidopsis best BAC match: AC004401.2
Arabidopsis position: 2.1320000
Arabidopsis identities: 0.739
Best GenBank protein hit: CAA10129.1
Evalue: 1.2e-31
Identities: 0.855
Description: hypothetical protein [Cicer arietinum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49571)
Chromosome
2
Position
30.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47505)
Chromosome
2
Position
16.10 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39874)
Chromosome
2
Position
13.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0888 was used as an overgo probe on plate 10 [well C11]

Plausible BAC Matches:   P306D07

 Overgo Sequences

A sequence
TTCTCTTTCCGACCTCTGAGTCTC
B sequence
CACCCATGATTTGCCTGAGACTCA
AB sequence
TTCTCTTTCCGACCTCTGAGTCTCAGGCAA
Marker sequence
GGAGCCCTGGCATTCCCCGCCACGCTTTAGCGTCGAATTAGAAAGGAGCC
CTAGGGTTTTTCTCTTTCCGACCTCTGAGTCTCAGGCAAATCATGGGTGG
AGGCAACGGTCAGAAAGCGAAGATGGCTCGGGAGAGGAATCTGGAGAAGC
TGAAGGGTGCTAAAGGAAGTCAGCTCGATACGAACAAAAAGGCCATGAAT
ATCCAGTGCAAGGTATGTATGCAGACATTTATGTGCACAACATCAGAGGT
GAAGTGTAAGGAACATGCTGAAGCAAAGCACCCAAAATCTGATCTCTATG
CTTGGTTTCCTCATCTCAAAAGTTGAAGTCCTTTTATGTGTCAAACATCC
TTGCAGAAAAAAAAAGTTGGTATGATTAATGATCTACCAGTCACTAAATG
CAACAGTCAGCTCAATCACGCTGTGAACTGTTTGTAGTTATTGTGTGTGT
GTTTGTGAGACTTGCAACTTGTGTTAATGGTTC
Genomic location of T0888  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1654 marker 1654
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)