SGN Marker T0890

SGN-M1655
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAO94TH
Arabidopsis best BAC match: AC007197.5
Arabidopsis position: 2.0810000
Arabidopsis identities: 0.709
Best GenBank protein hit: AAD25851.1
Evalue: 1.5e-50
Identities: 0.600
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49572)
Chromosome
1
Position
85.73 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47506)
Chromosome
1
Position
128.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39454)
Chromosome
1
Position
140.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0890 was used as an overgo probe on plate 10 [well A2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGAAGCCATCGATGTATCCTCAG
B sequence
GCAAGATACCTTTGGCCTGAGGAT
AB sequence
GAGAAGCCATCGATGTATCCTCAGGCCAAA
Marker sequence
TGGACGCGGTAAACAGAGATGGGAGACGAAAAGGTGAAGAATGAAGCAAT
GGAGATAATGGGATTGTTCCAAGTTCTTCCTCGTCTCGTCGTCTTCGATC
TTGATTATACCCTTTGGCCCTTTTATTGTGAATGCCGCTCCAAAAATGAG
AAGCCATCGATGTATCCTCAGGCCAAAGGTATCTTGCATGCCTTCAAAGA
CAAAGGAGTGAATGTTGCTATTGCCTCAAGATCGCCAACTCCAGATATAG
CAAATGCTTTCCTTCAAAAACTGGAGATAAAATCAATGTTTGTAGCCCAG
GAGATATTCTCCAGTTGGACACACAAGACGGAACACTTTCAGAAAATCAA
CCGAAAGACTACGGTGCCCTACAATGAGATGCTGTTTTTTGATGATGAAA
ATCGGAACATACAGGCGGTTTCAAAAATGGGTGTCACAAGTATATTGGTG
GGCAAAGGGGTAAATTTAGGGGCTTTGAGGCAAGGACTCTCCGAGTTTGG
TAAGAATTCTGCTTCAGTTGAAAAGAACAAAGAACAATGGCGCA
Genomic location of T0890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1655 marker 1655
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)