SGN Marker TG254

SGN-M168

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTAGTTGGATTGAAACAATTGGGAATATAGTGTAGGAAGACTTCGGGGCAATTATCTGCTTTCTTCTATATCAAACTGGGTCTATTGAAG
AATTACAAACTGGACCTTAAATCTTTTGCCAGTTTTTGTAAAATTGATAAACTTTTGATATTTTATTATGGAAATTCAAAATATATCTTA
ATAGTAGCTTGTTAATTTATTTCAAGAGACCCTTTTCATTGTTCATAGTTCATTATCATCCCCTTATCAGTAGTGCACCAAGGGTGTGAC
CTAGTGGTCAATTAAGTATGAATCATGAGTCTTAGACAGAAACACTAGGTGATTTTCTTCCATGTGTCCTAGCCTCTTAGGCTTGGTGGA
TAGAGGAGGTATCCTGTCTTTCCCCTTTCCAGAAATTCATAGCATTATTTTCTGTTCTTTATTGATAAATTATTCATTAGAACAGTTATT
AGAAATGTGGAACTGGTTGAGGTAGGCG
Reverse sequence
CAGAACAGAGAACATGTAAAGTTGTTCAACTAATGAGCATATTTAGAAAAACTTAGTGGCTATCAATAGTTGGCAATATGAAAACTAAGA
TAGTGTGGTCACCTGTTGATCAATTTCTTCTTCAATAGGCATCTTGTCAGCTTCCTCTTGTAACAAGGCTTTCATTTGTGACTTGAGAAT
ATATCCAGGAGGAAGTGCATGCCTGTAATGGCATTCTTTACCATTTGGACAGGCCCAGAACCAACCGTACTGCTTTTTCTCCACAGCATC
CAAAAAGAATTTACATACCTGCATATAAACCAAATCATAAGCTTGATTTATGAAACGAGCACTGCATTCATGTTTGGCAATATTTGACTG
GAGGAGGAGTTTTAAAGGGGGAAATTAAGACTATAGACACATACACTAAATATGCATAAAACGCCAAAAGTACCCTGGTTTCCTATCCAG
TTAAGGCAACAGTAGCAGAAAATGAGTGTTGTAATGAGTCAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1635701.4e-0728 (5.9% of RFLP seq)+
SGN-U1530633.1e-3371 (14.4% of RFLP seq)-
SGN-U1502371.9e-65125 (25.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53236)
Chromosome
9
Position
33.13 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53235)
Chromosome
9
Position
56.95 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42426)
Chromosome
9
Position
23.10 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39965)
Chromosome
9
Position
4.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8399)
Chromosome
9
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8401)
Chromosome
9
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8400)
Chromosome
9
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8406)
Chromosome
9
Position
14.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8405)
Chromosome
9
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35626
Forward primer (5'-3')
GACTTCGGGGCAATTATCTG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACGAGCACTGCATTCATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1700
Solanum lycopersicum LA925: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 108
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum pennellii LA716: 1700
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG254 was used as an overgo probe on plate 1 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTCCATGTGTCCTAGCCTCTTAGG
B sequence
TCCTCTATCCACCAAGCCTAAGAG
AB sequence
TTCCATGTGTCCTAGCCTCTTAGGCTTGGT
Marker sequence
CTAGTTGGATTGAAACAATTGGGAATATAGTGTAGGAAGACTTCGGGGCA
ATTATCTGCTTTCTTCTATATCAAACTGGGTCTATTGAAGAATTACAAAC
TGGACCTTAAATCTTTTGCCAGTTTTTGTAAAATTGATAAACTTTTGATA
TTTTATTATGGAAATTCAAAATATATCTTAATAGTAGCTTGTTAATTTAT
TTCAAGAGACCCTTTTCATTGTTCATAGTTCATTATCATCCCCTTATCAG
TAGTGCACCAAGGGTGTGACCTAGTGGTCAATTAAGTATGAATCATGAGT
CTTAGACAGAAACACTAGGTGATTTTCTTCCATGTGTCCTAGCCTCTTAG
GCTTGGTGGATAGAGGAGGTATCCTGTCTTTCCCCTTTCCAGAAATTCAT
AGCATTATTTTCTGTTCTTTATTGATAAATTATTCATTAGAACAGTTATT
AGAAATGTGGAACTGGTTGAGGTAGGCG
Genomic location of TG254  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D168 marker 168
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)