SGN Marker T0963

SGN-M1684
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAW34TH
Arabidopsis best BAC match: AB025604.1
Arabidopsis position: 5.2530000
Arabidopsis identities: 0.528
Best GenBank protein hit: BAA97482.1
Evalue: 6.8e-21
Identities: 0.500
Description: contains similarity to SL15 protein~gene_id:F2O15.15 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39882)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0963 was used as an overgo probe on plate 10 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCAGGAAAAAGCTCCCATGAGTG
B sequence
ACAGATCCCAAGGCAACACTCATG
AB sequence
TCCAGGAAAAAGCTCCCATGAGTGTTGCCT
Marker sequence
GACATGGATGAAAGGCTTATTATATTGTGCTGTAGCCCCAACTGTTTTGG
CAGGGCAAAGTAATCCTGTTCTTTTCGAGGCCTTATATGCTTCCCAACAT
GCAATCTTTATTCAGTGCAAGGATTCCGTACATATGGAAGAACTTTAAGG
GCAAAAGTACTGGTGAACTGAGCTTTTTGACCTTCTTCATGAACTTCGCC
GGTTCCATGGTTAGAGTTTTTACCAGCCTCCAGGAAAAAGCTCCCATGAG
TGTTGCCTTGGGATCTGTGATCGGTGTACTGATGAACGGTACCATCTTGA
GTCAAATTATCATATACCAAAAGCCAACACCTNCGAAAGGGAAGAAGAAA
GATTAGAAAGTTTCAGCACGCCGTGCTGCACCTGGAGCTCCATGATCGTC
GAGCACATAATTCATCCATATACTATATACCCTGAGAATCTGTCATAGTT
TTCGCTTATTTTCAAATTTTAGATTGATCCATCAGTTCCAGAATTTCATT
TTAACATTTACCATAGTCTCAGTATGGTATTTC
Genomic location of T0963  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1684 marker 1684
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)