SGN Marker T0991

SGN-M1697
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.99
Tomato EST read: TMGAE86TH
Arabidopsis best BAC match: AF128396.1
Arabidopsis position: 4.0560000
Arabidopsis identities: 0.823
Best GenBank protein hit: AAF72555.1
Evalue: 1.8e-53
Identities: 0.833
Description: cryptochrome 1 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39889)
Chromosome
12
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0991 was used as an overgo probe on plate 4 [well D7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTAGGAGGGATCTGAGGCTTGAAG
B sequence
GCCAGTGCTGGATTATCTTCAAGC
AB sequence
TTAGGAGGGATCTGAGGCTTGAAGATAATC
Marker sequence
GTTAAAGATAGGTGACACATTGTTGGTAATATTTTGAGGCAAAAAAAAAT
AAAATGTCAAGTGGTGGTTGTAGTATAGTATGGTTTAGGAGGGATCTGAG
GCTTGAAGATAATCCAGCACTGGCTGCTGCAGTGAGAGCAGGATCAGTGA
TTGCTGTGTTTATATGGGCACCAGAAGAAGAAGGATACTATTGCCCTGGA
AGAGTGTCAAGATGGTGGATTAAGAAAAGTTTGGCTCATCTTGATTCATC
TTTGAAGAAACTTGGCACTTCACTCATTACAAAGAGATCTAATGATAGTG
TTTCTTCTCTTCTTCAAGTTGTCAAATCTACCGGTGCAACTCGAGTTTTT
TTCAATCATTTATATGATCCAATATCACTTGTAAGGGATAATTGCGCAAA
GGAAACCTTATCAACTG
Genomic location of T0991  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1697 marker 1697
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)