SGN Marker TG46

SGN-M17

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATTAACCGACACTGATGTTTGTTCACTGAGTCAGCTAATGCATTGGTCCTAAACTCTTCAAGTTCTTTTATTAGCAATTGCCCTGCCCT
GGGATTACGTGATCCCAACCTCTGAGCACACAGAAGAACTGCTTGAACATCTTGAAGGCGATTTGTGCTGCTGGCAGACGAATCTATATT
GAAGAGAACTTTGTGGATATTTGATATTATTATATTCAGGGGATCTTCTGGATCATCAGCCAGAAGTGGATCCAAACCTTCTAGATCAAT
ATGCTCTGAGATAGCCCAAATAAGTCGAGTACATATTCTAGGAGTGTTCACCTGCAAGATGCAAGTTCCAGACAAATTTAAGAAACAATA
TGTCACCTGGTTAGTGAAGTAGTACAGAAGGTTGGAACATGACAAAGGTGAGCCTGAAGTAGAACAGAAATTACTAAATAAAACTCAATT
GTGGAAGAAAAGCACCCCGAATAACTTCAGATTATATATAGCTTTACCTTCTCCCCTTCCCTTCAGTTCAGTATTATGAAGGAAGGGGGA
CATAGTCAGAGAAGGTGTAGAGTTCCTTTAGCGGATGACATGCTGATGAACAAACTCTGTGCAGCTCAATATCATCTTAGCATAGGAAAA
AAACTAAGAAAAGTTAAGCTAGAATAATGC
Reverse sequence
CTGCAGGTTTCTTTATTTAATAAGCTGCTTCTTATGGTGAGAAACCTGAGAGCAGAGTCAGATCGCATGCATGCATTAGCATGCATTTGT
CGAACCGCTCTCTGTGTTGATCTTTTTGCAAAAGAGAGTGTTAGAAGAGGGCAAAAACCTGTTCCTGGAACCGATATTGCTTCACTTTTT
GAGAATGCAAGAATAAAAGAGGACCTCCATAGTGTAACAAGTAAAACCTTGTTTAGAGAAGAACTAGTTGCAATGCTGGTGGAGAGCTGC
TTTCAGTTATCACTGCCACTTCCTGAACAAAAAAATTCAGGTATGGAGAGCAGAGTTATTGGAGCTTTAGCATATGGAACTGGTTATGGT
GCATTAAACTGGACAGAACCAGCTTTGGAAGTGGTGGAAGTTTGTAGACCATGTGTCAAATGGGATTGTGAAGGTCGAACATATGCTATT
GACTGCTATTTGAAGTTGCTTGTCAGGCTTTGTCACATTTATGATACAAGAGGAGGTGTGAAAAGAGTCAAAGATGGGGCTTCTCAGGAC
CAGATTCTGAATGAAACGCGGTTGCAGAATTTGCAAAGGGATCTTGTCAAAGATCTACGTGAGGTTTGTTGAGCTTTTATAGTTATTTAA
TGACACATGTAATATGCAATTTGTCCTTGGAGATTGTTCTAGCCCATGGAATTGTATGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1686872e-4795 (14.4% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53859)
Chromosome
11
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

Fruit_diameter_fd11_1 pH_pH11_1 Sugar_content_suc11_1 Fruit_weight_fw11_1 Lycopene_content_lyc11_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53330)
Chromosome
11
Position
38.54 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50393)
Chromosome
11
Position
50.37 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48327)
Chromosome
11
Position
91.28 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42466)
Chromosome
12
Position
92.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40872)
Chromosome
11
Position
76.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36582
Forward primer (5'-3')
GCATTAGCATGCATTTGTCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CGACCTTCACAATCCCATTT
Digested band sizes (using AccI)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40049)
Chromosome
11
Position
74.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7752)
Chromosome
12
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7751)
Chromosome
11
Position
59.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7750)
Chromosome
11
Position
26.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG46 was used as an overgo probe on plate 3 [well G2]

Plausible BAC Matches:   P118P14,   P303G16,   P315O19,   P244K02,   P219N22

 Overgo Sequences

A sequence
TGGGATTACGTGATCCCAACCTCT
B sequence
GTTCTTCTGTGTGCTCAGAGGTTG
AB sequence
TGGGATTACGTGATCCCAACCTCTGAGCAC
Marker sequence
TATTAACCGACACTGATGTTTGTTCACTGAGTCAGCTAATGCATTGGTCC
TAAACTCTTCAAGTTCTTTTATTAGCAATTGCCCTGCCCTGGGATTACGT
GATCCCAACCTCTGAGCACACAGAAGAACTGCTTGAACATCTTGAAGGCG
ATTTGTGCTGCTGGCAGACGAATCTATATTGAAGAGAACTTTGTGGATAT
TTGATATTATTATATTCAGGGGATCTTCTGGATCATCAGCCAGAAGTGGA
TCCAAACCTTCTAGATCAATATGCTCTGAGATAGCCCAAATAAGTCGAGT
ACATATTCTAGGAGTGTTCACCTGCAAGATGCAAGTTCCAGACAAATTTA
AGAAACAATATGTCACCTGGTTAGTGAAGTAGTACAGAAGGTTGGAACAT
GACAAAGGTGAGCCTGAAGTAGAACAGAAATTACTAAATAAAACTCAATT
GTGGAAGAAAAGCACCCCGAATAACTTCAGATTATATATAGCTTTACCTT
CTCCCCTTCCCTTCAGTTCAGTATTATGAAGGAAGGGGGACATAGTCAGA
GAAGGTGTAGAGTTCCTTTAGCGGATGACATGCTGATGAACAAACTCTGT
GCAGCTCAATATCATCTTAGCATAGGAAAAAAACTAAGAAAAGTTAAGCT
AGAATAATGC
Genomic location of TG46  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17 marker 17
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)