SGN Marker TG255

SGN-M170

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1420
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTCTCCCGGTTTGGAAGGGATTAAATTTGATATTGTTTTGTATACACAAGATGAAGAAGACCTCTCATCGCTTGTTTGTTTCCCCTTGCA
AAGTAGTTCACTACAAAATTGGCTATCCATAACCTGATGATGCCCATCACCGCGTAGATATTTCAAGCAATCATGAGAATCAGCTGCGAT
ATACACAACAGGTGGCTGCCTCACAGTCTTGATCTTCTTCCAAGAGCCATGACGCAGAAAAGGTAACTGGAAGAGAAGGGAAAAACTGTC
AAGGAAGATCCACCAAGGATTTTTTTATTTTCTTTGTAAGAAGGGTGGGTGCTGTTTTCATTGTCATTACTGAAAACTAGTGGGGCATGA
GGGGTCAATTTTGTGCAGATCCCTAGTGATCTATGTTGTTAGGACTCTTCCAAAATGTCAATGGTGCATATTGGATCCTCCAGAAGTAGT
GCATATTTGGAGGATCCAACAT
Reverse sequence
AAATTTGTCAGAAGAGTTATCTTTATCTGCACATGTTAACAAAGCTTCAAAGCAGGTCAGGAGCCTAATTTTAGTTCATTCTTTATTTCT
AGAGCTATAACAAGGCCCTTTTTGGCTGCATTTTAACAATGAGCTGGGCAGAGGCAGAAATATATTTTAGGGCTGGCGACAGTTTCACAC
CAAAAACAAGTCTTACTGATTTACTGCACTAATCGGACTGTAAGTGTAAATCACGCAACATCAAGAAGAAAAAGAATTCAAAAATACACA
GCTGATATTCTAAATGTGTGTGTTGAGTGTTTCTCTATGTATATGTATGCATGTAGTTAACATGCTACAATTCTGTATATGTGAAAATTT
GCTGTGTGAGAAATAGCTTAAACATTGATTTGATGCGATCATCATTTTACATAACCACAGGCAAATACTTGAATGGAAAAGAAATACT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43851)
Chromosome
1
Position
123.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43594)
Chromosome
1
Position
105.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43312)
Chromosome
1
Position
125.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40850)
Chromosome
1
Position
128.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8412)
Chromosome
1
Position
117.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8413)
Chromosome
1
Position
143.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG255 was used as an overgo probe on plate 5 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCTATCCATAACCTGATGATGCC
B sequence
TATCTACGCGGTGATGGGCATCAT
AB sequence
GGCTATCCATAACCTGATGATGCCCATCAC
Marker sequence
TTCTCCCGGTTTGGAAGGGATTAAATTTGATATTGTTTTGTATACACAAG
ATGAAGAAGACCTCTCATCGCTTGTTTGTTTCCCCTTGCAAAGTAGTTCA
CTACAAAATTGGCTATCCATAACCTGATGATGCCCATCACCGCGTAGATA
TTTCAAGCAATCATGAGAATCAGCTGCGATATACACAACAGGTGGCTGCC
TCACAGTCTTGATCTTCTTCCAAGAGCCATGACGCAGAAAAGGTAACTGG
AAGAGAAGGGAAAAACTGTCAAGGAAGATCCACCAAGGATTTTTTTATTT
TCTTTGTAAGAAGGGTGGGTGCTGTTTTCATTGTCATTACTGAAAACTAG
TGGGGCATGAGGGGTCAATTTTGTGCAGATCCCTAGTGATCTATGTTGTT
AGGACTCTTCCAAAATGTCAATGGTGCATATTGGATCCTCCAGAAGTAGT
GCATATTTGGAGGATCCAACAT
Genomic location of TG255  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D170 marker 170
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)