SGN Marker T1001

SGN-M1702
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.04
Tomato EST read: TRXAE23TH
Arabidopsis best BAC match: AC021043.4
Arabidopsis position: 1.0616000
Arabidopsis identities: 0.841
Best GenBank protein hit: AAF88113.1
Evalue: 2.0e-51
Identities: 0.839
Description: "peroxisomal targeting signal type 2 receptor, Pex7p [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39456)
Chromosome
3
Position
74.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1001 was used as an overgo probe on plate 8 [well D4]

Plausible BAC Matches:   P183I10,   P012C22,   P020H14,   P306A11,   P306K17

 Overgo Sequences

A sequence
TGGCAACATGGAATGGACCCTAGA
B sequence
CCCTTTGTCAAGAAGCTCTAGGGT
AB sequence
TGGCAACATGGAATGGACCCTAGAGCTTCT
Marker sequence
TCCGTTGATAAGTCAATCAAGGTTTGGGATGTTAGGAATTATAGAGTGCC
AATATCAGTGCTTAATGGGCATGGATATGCAGTGAGGAAAGTGAGGTTTT
CACCACATAGAGCGAGTGCAATGGTTTCTTGTTCATATGACATGACAGTT
TGCATGTGGGATTACATGGTGGAAGATGCACTTATTGGGAGGTATGATCA
TCACACAGAGTTTGCTGTAAGAGTTGATATGAGCGTTCTCGTTGAAGGTC
TATTGGCTAGTACAGGATGGGATGAACTTGTTTATGTTTGGCAACATGGA
ATGGACCCTAGAGCTTCTTGACAAAGGGAAGTCAAACATTTTCTTCTTTT
TACTTTTATGTACTTAATGCTAAGAGAGGAAGTGAATAAACTGCTTATGT
TTGGAAACATGGAATGGGAACTATTTATGATGTCTGCTGTTGAAGTTGTA
AAATAATTCGAAGTTTCATTGTATTTAAGATTTTGGTAAAACCTTGGTAA
ATGACATTTACACC
Genomic location of T1001  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1702 marker 1702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)