SGN Marker T1003

SGN-M1703
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TRXAG03TH
Arabidopsis best BAC match: AP000371.1
Arabidopsis position: 3.0920000
Arabidopsis identities: 0.915
Best GenBank protein hit: BAB00408.1
Evalue: 1.5e-90
Identities: 0.908
Description: DegP protease precursor [Arabidopsis thaliana]
Comment: high sim with procaryotic proteases involved in proteolytic degradation : functions in plants in the thylakoid lumen
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39457)
Chromosome
2
Position
91.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1003 was used as an overgo probe on plate 13 [well D4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGATTCGAGGTGCTTCTGATCTC
B sequence
CAGCAAGAGTCACTTTGAGATCAG
AB sequence
GTGATTCGAGGTGCTTCTGATCTCAAAGTG
Marker sequence
TGGAAATATTGTTACTAATTATCATGTGATTCGAGGTGCTTCTGATCTCA
AAGTGACTCTTGCTGATCAAACTACTTATGATGCAAACGTTGTTGGATTT
GACCAAGATAAAGATGTTGCTGTGTTGCATATTGATGCACCAAAAGACAA
GTTGCGACCTATACCAATTGGCGTCTCGGCAGACTTGCTCGTTGGTCAAA
AAGTATTTGCTATTGGAAATCCATTTGGACTTGATCATACACTCACCACT
GGTGTAATCAGTGGGCTTAGGAGAGAAATCAATTCTGCGGCTACTGGCCG
ACCAATCCAAGATGTTATTCAGACAGATGCAGCAATCAATCCTGGTAACA
GTGGAGGGCCACTTATAGATAGTTCTGGAAATCTTATTGGAATAAATACT
GCTATATATTCTCCTTCCGGAGCATCATCAGGTGTTGGATTTTCAATTCC
AGTTGATACTGACAGTGGCATTGATGATCAGTTAGTGCAGTTTGGGAAAG
TCACAATGCCAATTCTGGGCATAACGATCGCACCTGATCAGTCCGTAGAG
CAACTGGG
Genomic location of T1003  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1703 marker 1703
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)