SGN Marker T1006

SGN-M1704
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.02.01
Tomato EST read: TRXAM55TH
Arabidopsis best BAC match: AC006248.3
Arabidopsis position: 2.0920000
Arabidopsis identities: 0.927
Best GenBank protein hit: CAA46941.1
Evalue: 6e-100
Identities: 0.949
Description: ferredoxin--nitrite reductase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39458)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39459)
Chromosome
1
Position
150.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1006 was used as an overgo probe on plate 15 [well H4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTCAACCTGCTTGTGGGTGGATTC
B sequence
ATCGCTTCGGACTGAAGAATCCAC
AB sequence
TTCAACCTGCTTGTGGGTGGATTCTTCAGT
Marker sequence
GGTTACCTGATGTGCCTGAGATTCTAAAGGGGCTTGATGAAGTTGGCTTG
ACTAGTCTGCAGAGTGGCATGGATAATGTTCGAAATCCGGTGGGGAATCC
TCTCGCAGGGATTGATCTTCATGAAATTGTAGACACAAGGCCTTACACTA
ATTTGCTGTCCCAATATGTCACCGCCAATTTTCGTGGCAATGTGGATGTG
ACTAACTTGCCAAGGAAGTGGAATGTATGTGTAATAGGGTCACATGATCT
TTATGAGCATCCGCATATCAATGATCTTGCGTATATGCCTGCAACCAAAG
ATGGACGATTTGGATTCAACCTGCTTGTGGGTGGATTCTTCAGTCCGAAG
CGATGTGCAGAGGCAATTCCTCTTGATGCATGGGTTCCAGCTGATGATGT
AGTCCCTGTTTGCAAAGCTATATTAGAAGCTTATAGAGATCTTGGTACCC
GAGGGAACAGGCAGAAAACAAGAATGATGTGGTTAATTGACGAACTGGGT
GTTGAAGGATTCAGGGCAAAAGTTGTGAAGAGAATGCCCCAAAAGAAGCT
AGATAGAGAATCTTCAGAGGATTTGGTCCTGAAACAATGGGAAAGGA
Genomic location of T1006  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1704 marker 1704
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)