SGN Marker T1012

SGN-M1706
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRXAU74TV
Arabidopsis best BAC match: AC009400.2
Arabidopsis position: 3.0140000
Arabidopsis identities: 0.860
Best GenBank protein hit: AAF02807.1
Evalue: 5.6e-63
Identities: 0.837
Description: putative glycerol-3-phosphate dehydrogenase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43007)
Chromosome
11
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44007
Forward primer (5'-3')
CCAAAACAGAGATCAAGAGGCAA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AAAGATGAGGGTGATGGTAGAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39460)
Chromosome
11
Position
21.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1012 was used as an overgo probe on plate 3 [well E4]

Plausible BAC Matches:   P096D22,   P110F16,   P162D06,   P069E10

 Overgo Sequences

A sequence
GCAGCATCGTTATGCTGGTGTTTG
B sequence
GCTGGTACCACTGATTCAAACACC
AB sequence
GCAGCATCGTTATGCTGGTGTTTGAATCAG
Marker sequence
GGATCAGGATAGTAACATTTGAATTCAATATCAAACCAAAACAGAGATCA
AGAGGCAAAAGTTGGTCACAATATAGACCTTTTTTTCAGATGCCTAATGA
GGAATAATGATTATATAAATATTTGACTTACAGGGATTTATATTAGAGGC
ACTATGATATTAAAAGAAAAACAATAAATGTCAGGATTGCTAGAAATCAA
CACACCTTAACATTAAGATAATCAGAGATGGCATCCAAAATGAATTCGAT
CTCATTCTCATGAGGTTCTGGCAGCATCGTTATGCTGGTGTTTGAATCAG
TGGTACCAGCTACTGTTCTGCCCAACCATGGAAGCATAAAGACCACTCGA
CCATCCTTAGTTTTAGGGACAATCAAGCCCATCCCGTCTGGAGAATAATA
ATCAGGAAGTATAATATGTACACCACTACTGGGACAAATCATGGGTTTTG
CATCTTTATCAGCTAACGTCCGTACAGAATCACAAAAAGGCCCGGCAGCG
TTAACAACAACTTTTGCATATGCATCAAACTCCTTCCCTGATAAATTATT
CCGGATACGTGCACCAATTATTCTACCATCACCCTCATCTTTGAGAAGGG
ATACCACTT
Genomic location of T1012  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1706 marker 1706
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)