SGN Marker T1013

SGN-M1707
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.01
Tomato EST read: TRXAW10TH
Arabidopsis best BAC match: AB007651.1
Arabidopsis position: 5.0300000
Arabidopsis identities: 0.894
Best GenBank protein hit: CAB76908.1
Evalue: 4e-109
Identities: 0.951
Description: putative Ruv DNA-helicase [Cicer arietinum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39461)
Chromosome
6
Position
43.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1013 was used as an overgo probe on plate 1 [well D3]

Plausible BAC Matches:   P127G12,   P019M07,   P095F10,   P074J06

 Overgo Sequences

A sequence
AGGAGAGGTGACTGAACTATCTCC
B sequence
ACTCTCACCCTCTTCTGGAGATAG
AB sequence
AGGAGAGGTGACTGAACTATCTCCAGAAGA
Marker sequence
GAAGAAAATGGCTGGGCGGGCTTTACTGCTAGCTGGTCCGCCTGGTACGG
GGAAGACAGCTCTTGCTCTTGGTATATCACAAGACCTTGGAAGCAAGGTT
CCATTTTGTCCAATGGTTGGGTCCGAAGTGTATTCATCAGAAGTGAAGAA
AACTGAGGTCTTAATGGAAAACTTCCGGCGAGCTATTGGTCTCCGTATGA
AGGAAAATAAGGAAGTTTATGAAGGAGAGGTGACTGAACTATCTCCAGAA
GAGGGTGAGAGTGTGACAGGTGGATATGGTAAAAGCATTAGCCATGTTAT
AATTGGGTTAAAAACTGTCAAAGGTACCAAACAGTTGAAGCTTGACCCCA
CGATATATGATGCCATAATTAAAGAGAAGGTAGCTGTTGGTGATGTCATT
TACATTGAATCAAACAGTGGAGCAGTTAAAAGAGTGGGCAGGAGTGATGC
TTTTGCCACAGAATTTGATCTTGAGGCAGAAGAGTATGTTCCACTTCCTA
AAGGAGAGGTTCACAAGAAGAAGGAAATAGTCCAGGATGTTACATTGCAT
GATCTTGATGCTGCAAATGCACGGCCACAAGGAGGACAAGATATATTGTC
CCTTATGGGTCAAATGATGAAACCTA
Genomic location of T1013  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1707 marker 1707
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)